ID: 1063927543

View in Genome Browser
Species Human (GRCh38)
Location 10:10995353-10995375
Sequence AGGTGCTCAAAAATACTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063927543_1063927545 -9 Left 1063927543 10:10995353-10995375 CCAGCCAGTATTTTTGAGCACCT No data
Right 1063927545 10:10995367-10995389 TGAGCACCTATTTTTATGCTTGG No data
1063927543_1063927547 20 Left 1063927543 10:10995353-10995375 CCAGCCAGTATTTTTGAGCACCT No data
Right 1063927547 10:10995396-10995418 ATATTTAAGCTCAGCCCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063927543 Original CRISPR AGGTGCTCAAAAATACTGGC TGG (reversed) Intergenic
No off target data available for this crispr