ID: 1063929934

View in Genome Browser
Species Human (GRCh38)
Location 10:11018390-11018412
Sequence GAGCGCGGCGTCCCGGGGAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063929928_1063929934 -7 Left 1063929928 10:11018374-11018396 CCCGGAGGGACGAGCGGAGCGCG 0: 1
1: 0
2: 0
3: 13
4: 66
Right 1063929934 10:11018390-11018412 GAGCGCGGCGTCCCGGGGACCGG No data
1063929929_1063929934 -8 Left 1063929929 10:11018375-11018397 CCGGAGGGACGAGCGGAGCGCGG 0: 1
1: 0
2: 3
3: 9
4: 79
Right 1063929934 10:11018390-11018412 GAGCGCGGCGTCCCGGGGACCGG No data
1063929923_1063929934 17 Left 1063929923 10:11018350-11018372 CCGGCGGTGCAGGGCGCGGGGCT 0: 1
1: 0
2: 4
3: 40
4: 586
Right 1063929934 10:11018390-11018412 GAGCGCGGCGTCCCGGGGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063929934 Original CRISPR GAGCGCGGCGTCCCGGGGAC CGG Intronic
No off target data available for this crispr