ID: 1063930656

View in Genome Browser
Species Human (GRCh38)
Location 10:11025482-11025504
Sequence TTCTTGCCACCTTGTGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063930646_1063930656 5 Left 1063930646 10:11025454-11025476 CCCTTCCCCCTTCGTTCAACGCT 0: 1
1: 0
2: 0
3: 8
4: 100
Right 1063930656 10:11025482-11025504 TTCTTGCCACCTTGTGAGGGAGG No data
1063930648_1063930656 0 Left 1063930648 10:11025459-11025481 CCCCCTTCGTTCAACGCTTTCCC 0: 1
1: 0
2: 1
3: 5
4: 106
Right 1063930656 10:11025482-11025504 TTCTTGCCACCTTGTGAGGGAGG No data
1063930645_1063930656 24 Left 1063930645 10:11025435-11025457 CCGATGGTTTTATAAGGGGCCCT 0: 2
1: 14
2: 43
3: 106
4: 222
Right 1063930656 10:11025482-11025504 TTCTTGCCACCTTGTGAGGGAGG No data
1063930650_1063930656 -2 Left 1063930650 10:11025461-11025483 CCCTTCGTTCAACGCTTTCCCTT 0: 1
1: 0
2: 1
3: 9
4: 100
Right 1063930656 10:11025482-11025504 TTCTTGCCACCTTGTGAGGGAGG No data
1063930647_1063930656 4 Left 1063930647 10:11025455-11025477 CCTTCCCCCTTCGTTCAACGCTT 0: 1
1: 0
2: 0
3: 6
4: 90
Right 1063930656 10:11025482-11025504 TTCTTGCCACCTTGTGAGGGAGG No data
1063930651_1063930656 -3 Left 1063930651 10:11025462-11025484 CCTTCGTTCAACGCTTTCCCTTC 0: 1
1: 0
2: 0
3: 9
4: 109
Right 1063930656 10:11025482-11025504 TTCTTGCCACCTTGTGAGGGAGG No data
1063930649_1063930656 -1 Left 1063930649 10:11025460-11025482 CCCCTTCGTTCAACGCTTTCCCT 0: 1
1: 0
2: 2
3: 8
4: 111
Right 1063930656 10:11025482-11025504 TTCTTGCCACCTTGTGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063930656 Original CRISPR TTCTTGCCACCTTGTGAGGG AGG Intronic
No off target data available for this crispr