ID: 1063939711

View in Genome Browser
Species Human (GRCh38)
Location 10:11115112-11115134
Sequence CTGCATATTAATCTGCATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 113}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063939711_1063939713 -4 Left 1063939711 10:11115112-11115134 CCAGGATGCAGATTAATATGCAG 0: 1
1: 0
2: 0
3: 14
4: 113
Right 1063939713 10:11115131-11115153 GCAGTAGGCACGTGAATATCTGG No data
1063939711_1063939714 -1 Left 1063939711 10:11115112-11115134 CCAGGATGCAGATTAATATGCAG 0: 1
1: 0
2: 0
3: 14
4: 113
Right 1063939714 10:11115134-11115156 GTAGGCACGTGAATATCTGGAGG No data
1063939711_1063939715 8 Left 1063939711 10:11115112-11115134 CCAGGATGCAGATTAATATGCAG 0: 1
1: 0
2: 0
3: 14
4: 113
Right 1063939715 10:11115143-11115165 TGAATATCTGGAGGTCAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063939711 Original CRISPR CTGCATATTAATCTGCATCC TGG (reversed) Intronic
900859555 1:5218325-5218347 CTGCATGTTTAACTTCATCCTGG - Intergenic
906198262 1:43943187-43943209 CTGCATATTTAGCTGCCTCCTGG - Intergenic
906819064 1:48910492-48910514 CTGCATATTTTTCTGCATCTGGG - Intronic
909753631 1:79195329-79195351 CTGCCTACTCCTCTGCATCCAGG + Intergenic
910348139 1:86264388-86264410 CTGCATATTAACCTACATTTGGG + Intergenic
910396662 1:86800539-86800561 CTGCATTTTTCTCTGCAGCCTGG - Intergenic
911856036 1:102876160-102876182 TTGCATATTAGCCTGCATCAGGG - Intergenic
915962903 1:160282093-160282115 CTGCATAATACTCTGCATGATGG + Exonic
916208773 1:162341342-162341364 CTGTATTTTAATCTGTACCCTGG + Intronic
916219072 1:162425000-162425022 AAGCATCTTAATCTCCATCCAGG - Intergenic
1063939711 10:11115112-11115134 CTGCATATTAATCTGCATCCTGG - Intronic
1069504944 10:68989231-68989253 CTGCATCTCTCTCTGCATCCAGG + Exonic
1071285527 10:84140453-84140475 CTACATTTTAAGATGCATCCGGG + Intronic
1072062233 10:91824679-91824701 CTTCATGTTAATCTGCAAACTGG - Intronic
1074228624 10:111512213-111512235 CTGCATCTTCACCTGCCTCCTGG + Intergenic
1074767061 10:116707248-116707270 CTGCATATTCATCTCCAGCCCGG - Exonic
1074963952 10:118472502-118472524 CTGCATTTTAATCAGCTCCCCGG + Intergenic
1084374110 11:68764322-68764344 CTGCACATTAGTGTGCACCCTGG + Intronic
1086149754 11:83595931-83595953 CTGCAAATTTATTTGCATCTGGG - Intronic
1086965061 11:93018976-93018998 CTGCATTTTTATCAGCATCCTGG + Intergenic
1092014752 12:5149422-5149444 CTGGAAATTTATCTGCAGCCGGG + Intergenic
1096661722 12:53129427-53129449 CTTAATCTTAATCTGCATGCAGG + Intergenic
1097158133 12:57027383-57027405 CAGCAGATTAATCTGCAGGCAGG + Intronic
1098565180 12:71926946-71926968 CTGCATTTTAACAAGCATCCAGG + Exonic
1102435388 12:112918900-112918922 CTGCATACTAAATTCCATCCTGG - Intronic
1106795377 13:33199890-33199912 GTGCTTATTATACTGCATCCTGG - Intronic
1106939140 13:34757542-34757564 CTAGATATTAATATGTATCCAGG - Intergenic
1108614841 13:52122174-52122196 CTGCTGATTACTGTGCATCCTGG + Intronic
1108756532 13:53509893-53509915 TTGCATTTGAATCTTCATCCCGG - Intergenic
1113533332 13:111045273-111045295 CTGCATCTACATCTGCAGCCAGG + Intergenic
1115356337 14:32452353-32452375 CTGCATATTAATCCACTGCCTGG + Intronic
1115493250 14:33979210-33979232 CTGCATATGGCTCTGCAACCTGG - Intronic
1119288132 14:73472741-73472763 CGTCATTCTAATCTGCATCCAGG - Intergenic
1120840369 14:89080233-89080255 CTGCATCTTGGTCTGGATCCTGG + Intergenic
1122258651 14:100499573-100499595 ATGCATGTTCACCTGCATCCTGG + Intronic
1124014094 15:25862021-25862043 CTTCATCTTAACCTGCTTCCTGG - Intronic
1124595772 15:31090334-31090356 TTCCATATGAAACTGCATCCTGG + Intronic
1126663815 15:51057352-51057374 CTGCTTAATAGTCTACATCCAGG + Exonic
1127611059 15:60637508-60637530 CTGCATATTTATCTAGATACAGG - Intronic
1133423640 16:5668568-5668590 CTTCAGATTAAACTGCAGCCTGG + Intergenic
1134471090 16:14526530-14526552 CTGCTTATTAACTTGCATCTTGG - Intronic
1135115957 16:19723643-19723665 CTGCATTTTAACATGTATCCAGG - Intronic
1137758486 16:50921128-50921150 CTTCAAATTCATCTGAATCCTGG + Intergenic
1143702848 17:8674424-8674446 CTATATCTTAATCTGCACCCTGG - Intergenic
1145037528 17:19551766-19551788 CTGCATTTTAACCAGCGTCCTGG + Intronic
1146978794 17:37140455-37140477 ATGCATATTGATCTGTAGCCAGG - Intronic
1149577240 17:57722993-57723015 CTGGATATTAAGCTGCTTCCTGG - Intergenic
1152302901 17:79505858-79505880 CTGCATATTTCACTGAATCCAGG + Intronic
1155926258 18:31658670-31658692 CAGCAAATTAAACTGCATACAGG + Intronic
1157490997 18:48123621-48123643 CTGCATGTTAAACTGCTTCCTGG + Intronic
1157593943 18:48852484-48852506 CTGCTTACTAATCTTTATCCCGG + Intronic
1167715521 19:51140640-51140662 CTGCAGACCAATCTGCCTCCTGG - Intergenic
928116968 2:28552323-28552345 CTCCATATTTCCCTGCATCCAGG - Intronic
928812509 2:35246794-35246816 ATGCATATTAATCTCCCTCCGGG - Intergenic
930392153 2:50775164-50775186 CTGCATTTCAATCTCCATCCAGG + Intronic
930900743 2:56504996-56505018 GAGCATAATAATCTGCTTCCTGG - Intergenic
932103151 2:68919282-68919304 CTGCATTTTTATATACATCCAGG - Intergenic
932787068 2:74615190-74615212 CTGCCAATTAATCTGAAACCTGG - Intronic
934064582 2:88329114-88329136 CTGCATATTAACCTGTGTCTTGG + Intergenic
939584513 2:143990298-143990320 CTACATATTAATGGGCAGCCAGG + Intronic
946826671 2:223686148-223686170 CTGCATTTTAATCTACTCCCTGG - Intergenic
1179527494 21:41992015-41992037 CAGCATATAAAAATGCATCCAGG - Exonic
1185187197 22:49408117-49408139 CTGCATATTAAACTGGAAGCAGG - Intergenic
953786355 3:45914578-45914600 CTGCATTTTAATATGCCTTCAGG + Intronic
965870890 3:173264032-173264054 CTTTATGTTAATCTGCATCTGGG - Intergenic
968057299 3:195702019-195702041 CTGCCTGTTAATCTGGATCTGGG - Intergenic
972902610 4:43703311-43703333 CTGCATCTTCATCTGCATTAGGG + Intergenic
972982872 4:44726576-44726598 CTGCGCCTTTATCTGCATCCGGG - Exonic
973707376 4:53593626-53593648 CTGCATATTATTCGAAATCCAGG - Intronic
974615977 4:64283276-64283298 CTGAGTATTAATCTCCATCCTGG + Intronic
975676515 4:76832588-76832610 CTGCATATTGAAAAGCATCCTGG + Intergenic
977908647 4:102505095-102505117 CAGTATATTAATTTGCACCCAGG - Intronic
979633369 4:122928645-122928667 CTGGAAATTAAACTACATCCAGG - Intronic
982962702 4:161860478-161860500 TTTCATATCAATCTGCTTCCAGG + Intronic
984796385 4:183663939-183663961 CTGCATTATAAACTACATCCAGG - Exonic
986460924 5:7971507-7971529 CAGCATATTTATCTCCTTCCTGG + Intergenic
986938997 5:12927015-12927037 CTGAAGATGAATCTGCTTCCAGG + Intergenic
986953609 5:13122820-13122842 TTGCAGATTATTCTGCATCAAGG - Intergenic
988042760 5:25910322-25910344 CCGCTTGTTAATCTGCAGCCAGG - Intergenic
989595992 5:43156660-43156682 CTGCATATTACTTTGCATTTGGG + Intronic
989743508 5:44799798-44799820 CTGCATATCAAAATGCCTCCAGG - Intergenic
992856382 5:80865949-80865971 GTATCTATTAATCTGCATCCAGG + Intronic
999871271 5:155753804-155753826 ATGCATATCAATGTGTATCCAGG - Intergenic
1000461822 5:161531653-161531675 CTGCATATTAGTCTGCTACTGGG - Intronic
1002656167 5:180749160-180749182 GTGCATATGACTCTGCATCCTGG + Intergenic
1004039295 6:11960133-11960155 CTGCATAGTAATCTGTGACCAGG - Intergenic
1007986802 6:46215433-46215455 CAGCATCTGCATCTGCATCCCGG - Intergenic
1008805319 6:55419743-55419765 CAGCTAATTAATCTGCAACCTGG + Intergenic
1011979539 6:93355933-93355955 CTGCATTTTAATATGCATGAGGG - Intronic
1012191692 6:96287635-96287657 AGGCAGAATAATCTGCATCCAGG + Intergenic
1014252933 6:119133365-119133387 CTGCATGTTAATCTCCATTTCGG - Intronic
1018493692 6:164325362-164325384 CAGCATATTTATCTGTATCAGGG + Intergenic
1018835500 6:167480375-167480397 CTGCATATTATACTCCACCCTGG + Intergenic
1021147156 7:17103119-17103141 CTGCAAATTAATCTGCTTTGAGG + Intergenic
1021808593 7:24380606-24380628 CTGCATATTAAACAGCTTCTTGG - Intergenic
1021869197 7:24986857-24986879 CTCCACATTGATCTGCTTCCAGG + Intergenic
1022293864 7:29030946-29030968 CTTCATAGTAATCTGCATAAAGG + Intronic
1024753966 7:52506025-52506047 CTGCCTATAAATCTACCTCCAGG + Intergenic
1026640173 7:72117460-72117482 CTGCATTTTAATCTTAATGCTGG + Intronic
1026897517 7:74018794-74018816 CTGCATCTTTCTCTGCACCCCGG - Intergenic
1030098916 7:105927104-105927126 CTCCATTTTAATGTGCAGCCAGG - Intronic
1030586512 7:111426518-111426540 TTGCATTTTTATTTGCATCCTGG - Intronic
1031159347 7:118147538-118147560 TTTTATATTAATCTGCATGCTGG + Intergenic
1032539794 7:132693593-132693615 CTGCATTTTAATTTGCTCCCAGG - Intronic
1035646350 8:1224001-1224023 CTTCATATTAATCCACATCAAGG - Intergenic
1035733273 8:1867832-1867854 CTGATTATTAAACTGCCTCCTGG + Intronic
1044601792 8:94012492-94012514 CTCCAAATTAAACTGCTTCCTGG + Intergenic
1046192311 8:110812487-110812509 CTGCTTTTTAAACTGCATGCTGG + Intergenic
1046548963 8:115688320-115688342 CTGCACATTAATCTGTCTGCAGG + Intronic
1047328991 8:123867870-123867892 CTGCATCTTGATCTGGATGCTGG - Intronic
1050270698 9:3941468-3941490 CTGCACTTTAATCTGCCACCAGG + Intronic
1051817856 9:21130893-21130915 ATGCATATTAATTTGAATGCAGG - Intergenic
1055748862 9:79481908-79481930 TTACATATTGATCTGCATGCTGG + Intergenic
1057510931 9:95678923-95678945 CTGCAGCTGCATCTGCATCCAGG + Intergenic
1057901837 9:98955160-98955182 CTGCATCTTAGACTGCACCCAGG - Intronic
1058147776 9:101430776-101430798 CTACAGATTCATCTGCAGCCAGG + Exonic
1058942134 9:109823129-109823151 CTGGAAGTTAATCTGCATCCAGG - Intronic
1062082626 9:134632423-134632445 ATGCATATTTACATGCATCCTGG - Intergenic
1185557357 X:1031854-1031876 CTTCATATTAATCGGCAGCCGGG + Intergenic
1186734003 X:12441538-12441560 CTGCCTATCATTTTGCATCCTGG - Intronic
1187215034 X:17267871-17267893 CTCCATCAGAATCTGCATCCTGG - Intergenic
1187302561 X:18065241-18065263 CAGGATATTATTCTGCATCAGGG - Intergenic
1188470294 X:30530422-30530444 CTGGGTTTTAATATGCATCCTGG + Intergenic
1194668371 X:96700467-96700489 CTGCATCTGCATCTGCATCCAGG - Intronic
1196224030 X:113144244-113144266 CTGTATTTTAATCTGCCTCCTGG + Intergenic
1197311045 X:124905793-124905815 CTGCATATTCACCTGCACTCTGG + Intronic
1197528905 X:127598641-127598663 CTGGAAAATAATCTGCTTCCAGG - Intergenic
1197908496 X:131453618-131453640 GTGCATATCAAACAGCATCCAGG - Intergenic