ID: 1063944674

View in Genome Browser
Species Human (GRCh38)
Location 10:11165254-11165276
Sequence CTGCTGTCGAGCAGAGCCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 101}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063944674_1063944681 19 Left 1063944674 10:11165254-11165276 CCCCCGGCTCTGCTCGACAGCAG 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1063944681 10:11165296-11165318 CGCCGCCGAGGAGCAACTCATGG 0: 1
1: 0
2: 0
3: 3
4: 27
1063944674_1063944678 7 Left 1063944674 10:11165254-11165276 CCCCCGGCTCTGCTCGACAGCAG 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1063944678 10:11165284-11165306 TGAGAGCCTCGCCGCCGCCGAGG 0: 1
1: 0
2: 1
3: 3
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063944674 Original CRISPR CTGCTGTCGAGCAGAGCCGG GGG (reversed) Intronic
900631834 1:3640597-3640619 CTGCTGACGCTCAGAGCCTGGGG - Intronic
903686396 1:25135384-25135406 CTGCTTTGGAGAAGAGCTGGGGG + Intergenic
904402271 1:30264549-30264571 CTGCTGTCCAGCAGATCTGCTGG + Intergenic
912141681 1:106737511-106737533 CTTCTGTCAAGCTGAGCTGGTGG + Intergenic
917485900 1:175454421-175454443 CTGCAGTCCAGCAGAGCCCTCGG + Intronic
921055373 1:211538826-211538848 CTGCTCTCGAGAAGCCCCGGGGG - Intergenic
921148687 1:212382966-212382988 CTGCTGCAGAGCAGAGCTGCGGG + Intronic
922196781 1:223365261-223365283 CCGCGGGCGATCAGAGCCGGCGG - Intergenic
922218133 1:223537592-223537614 ATGCTCTGGAGCAGAGCCAGGGG - Intergenic
1063665122 10:8056167-8056189 CTGCAGCCGCGCAGAGACGGAGG - Intronic
1063929917 10:11018334-11018356 GTGCGGACGAGCAGCGCCGGCGG + Intronic
1063944674 10:11165254-11165276 CTGCTGTCGAGCAGAGCCGGGGG - Intronic
1064024737 10:11838438-11838460 CTGCTGTTGAGAAGAGTTGGTGG - Intronic
1064189731 10:13195307-13195329 ATTCTGTAGAGCAGAGCTGGAGG + Intronic
1064227940 10:13503987-13504009 CTGCTGTGGAGTAGAGCCCCAGG - Intronic
1067921471 10:50462828-50462850 GTGGAGTCGAGCAGAGCTGGTGG + Intronic
1071835726 10:89415189-89415211 CCGCTGCCGAGAAGAGCCGTCGG - Intronic
1076755851 10:132571267-132571289 CTCCTGCCGAGCAGAGGAGGAGG + Intronic
1077317292 11:1925239-1925261 CTGCAGCTGAGGAGAGCCGGGGG - Intronic
1078011409 11:7575840-7575862 GTGCTGTGGAGCAGGGCCAGAGG + Intronic
1080610017 11:33895867-33895889 CTGCTGTCTGGTAGAGCAGGTGG - Intergenic
1080836316 11:35944123-35944145 CTGCTGCTGAGCAGCGCCGCGGG + Exonic
1081726110 11:45330522-45330544 CAGCAGTCTAGCAGAGCAGGAGG - Intergenic
1083842118 11:65310502-65310524 CTGCTGTCATTCAGAGCAGGGGG - Intergenic
1089543686 11:119206365-119206387 TCGCAGTCGAGCCGAGCCGGCGG + Exonic
1090375971 11:126289746-126289768 TTTCTGTGGAGCAGAGCCTGTGG - Exonic
1091119510 11:133045138-133045160 CAGCTTTGGAGCAGAGCCGGGGG - Intronic
1091346263 11:134856427-134856449 CTGCTGTCGTGCAGGGGCTGAGG + Intergenic
1091433230 12:453746-453768 CTGATGACGGGCAGAGCCGCTGG - Intergenic
1092022041 12:5210830-5210852 CTGTTGCCGTGCAGAGCAGGAGG - Intergenic
1092147798 12:6226847-6226869 ATGCTGTCCTGCAGAGCAGGAGG + Intronic
1095110745 12:38292792-38292814 ATGCTGTTGAGCAGAGCTGTGGG - Intergenic
1097675975 12:62603051-62603073 CTGCTGTTTGGCGGAGCCGGCGG + Exonic
1098426087 12:70366616-70366638 CTGCTGTCGCGCGGCGGCGGCGG + Exonic
1101323856 12:103697598-103697620 CTGCTGTGGAGCAGGGAGGGAGG - Intronic
1102009024 12:109606770-109606792 CTGCCGGGGAGCAGAGCGGGCGG - Intergenic
1102104655 12:110311193-110311215 CTGCTGTAGAGCAGAGGAGTTGG + Intronic
1103177963 12:118880902-118880924 CTGCTTTTGTGCAGAGCTGGTGG + Intergenic
1103261957 12:119595258-119595280 CTGCAGGCGAGGTGAGCCGGTGG - Intronic
1104447274 12:128844646-128844668 CTTCTGTCCTCCAGAGCCGGAGG + Intergenic
1104980284 12:132570492-132570514 CTGCTGGCCGGCAGCGCCGGGGG - Exonic
1119223343 14:72926494-72926516 CTCCTGCAGAGCTGAGCCGGAGG + Exonic
1121017704 14:90558400-90558422 CTGCTGCAGAGCAGCGCCCGGGG - Intronic
1121246468 14:92464585-92464607 CTACTGTCCAGCAGGGCTGGGGG - Intronic
1122236023 14:100330987-100331009 CTGCTGTGGTGGAGACCCGGTGG - Intergenic
1122542740 14:102507140-102507162 CTCCTGGCGGGCCGAGCCGGCGG + Exonic
1122806487 14:104262634-104262656 CTGCTGTGGACCAAAGCCAGAGG + Intergenic
1122996874 14:105269841-105269863 CTGCTGTGGAGCAGGGCCTAGGG - Intronic
1123091904 14:105745663-105745685 CTGCAGGTGAGCAGGGCCGGTGG - Intergenic
1123122231 14:105922013-105922035 CTGCTCTGGTGCAGAGCCTGGGG - Intronic
1125745519 15:41994937-41994959 CTGCTGGTGAGCAGGGCCAGGGG - Intronic
1129519693 15:76177960-76177982 CTGATGTGGAGCAGAGCCCTGGG + Intronic
1130928624 15:88404023-88404045 CTGCAGTGGAGCAGAGAGGGAGG - Intergenic
1132496471 16:265685-265707 CTGCTCTGGAGCTGAGCCCGTGG + Exonic
1132701846 16:1225335-1225357 CTGCTGTCAGGCAGGGCGGGAGG + Intergenic
1133897549 16:9943905-9943927 CTGCTGTTGAGAAGAGACAGAGG - Intronic
1136651256 16:31673527-31673549 CTGCAGTGGAGCAAAGCCAGGGG - Intergenic
1137510649 16:49097016-49097038 CTGCTGGCTAGCAGAGCAGTGGG - Intergenic
1139917966 16:70439570-70439592 CTGCTGACGAGCCCGGCCGGAGG + Intergenic
1142176643 16:88648281-88648303 CTGGTGAAGAGCAGAGCCTGTGG + Intronic
1142523420 17:520710-520732 CTGCTGGGGAGGAGAGCCTGTGG - Intronic
1146654661 17:34628174-34628196 CTGTTGCCCAGCAGAGCCTGTGG + Intronic
1152433012 17:80260247-80260269 CTGCGGCCGCGCAGAGCCGGCGG - Intergenic
1158976565 18:62715927-62715949 CCGCTGCCGGGCAGAGCGGGGGG + Exonic
1160201849 18:76802279-76802301 CTGGGCTGGAGCAGAGCCGGAGG + Intronic
1160685604 19:435134-435156 CTGCTGCCGGGCGGGGCCGGAGG - Intronic
1165225185 19:34349753-34349775 ATGCTGTAGAGCAGAGTGGGAGG + Intronic
1165537376 19:36460431-36460453 CTGCTGTTGAGCCTAGCCAGTGG - Intronic
1166197971 19:41219230-41219252 CGGCTGCTGGGCAGAGCCGGTGG + Exonic
926739661 2:16100964-16100986 CTTCTCTGGAGCAAAGCCGGCGG + Intergenic
928312193 2:30220301-30220323 CTCCAGTCGAGCAGAGGCTGAGG + Intergenic
933835135 2:86239938-86239960 GTGCTGGTGAGCAGAGCCGGTGG + Intronic
935019357 2:99215263-99215285 CTGCTGTCCAGCTCAGCCTGGGG + Intronic
937912995 2:127085220-127085242 CTGCTGGAGAGCAGAGCCCAGGG + Intronic
938369799 2:130762034-130762056 CTGCTGTGGAGGAAAGCAGGAGG - Exonic
940136370 2:150440659-150440681 CTGCTATCAAGCAGAGCCAGAGG - Intergenic
1168828913 20:833776-833798 CCGCGGTCGAGCTGAGCGGGTGG - Exonic
1178493992 21:33071494-33071516 CTGCGCTCGAGCAGTGGCGGGGG + Exonic
1179174808 21:39000674-39000696 CTGCTTTGCAGCAGAGCCAGGGG - Intergenic
1180181898 21:46121791-46121813 CTGCTGAAGAGGAGAGCCAGGGG - Intronic
1184368734 22:44069111-44069133 CTGCAGACCAGCACAGCCGGCGG - Intronic
954108407 3:48421224-48421246 GTGCTGCCGAGAGGAGCCGGTGG - Exonic
956730404 3:72191101-72191123 CTGTTGTCCAGCAAAGCCAGAGG + Intergenic
958142868 3:89586042-89586064 CTGATGTCAAGCAGAGTCTGAGG + Intergenic
961825448 3:129596774-129596796 CTGCTGCAGAGCACAGCCTGCGG - Intronic
964710955 3:159671080-159671102 CTGCTGATGAACAGAGCAGGTGG + Intronic
965653114 3:170953905-170953927 CTGCTGCCGAGCAAAACCGGAGG + Intergenic
969256152 4:6003041-6003063 CTGCTGCAGGGCAGAGCAGGTGG - Intergenic
969257436 4:6011776-6011798 TTCCTGTCCAGCAGAGCCGTGGG - Intergenic
986739968 5:10697293-10697315 CGGCTGTCCAGCAGGGCCTGAGG + Intronic
990937034 5:61162348-61162370 CTGGTGTCCAGCAGAAACGGCGG - Exonic
1002527632 5:179823745-179823767 ATGCTGGAGAGCAGGGCCGGGGG + Intronic
1003510235 6:6773371-6773393 CTGCAGTCTAGCAGGGCTGGTGG - Intergenic
1007783782 6:44268931-44268953 CGGCTGTCCAGAAGAGGCGGGGG - Intergenic
1015734964 6:136389375-136389397 CTGCTGTGGAGGAGAAGCGGAGG - Exonic
1018795233 6:167180113-167180135 CTGCTGCCGGGCAGAACTGGAGG + Intronic
1018821087 6:167374949-167374971 CTGCTGCCGGGCAGAACTGGAGG - Intronic
1018848272 6:167570282-167570304 CTGCTGTGGAGCAGACCCATAGG - Intergenic
1020522559 7:9211263-9211285 CTGCTGTCTAGAAGAGCCTAAGG - Intergenic
1023838238 7:44080797-44080819 CTTATGTCCAGCAGAGCTGGGGG + Exonic
1024696857 7:51866791-51866813 CTGCTGATGAGCAGAGCATGGGG + Intergenic
1025231060 7:57203598-57203620 CTGCTGCCGAGCAGAGGAGCGGG - Intergenic
1043355337 8:79404935-79404957 CTGGGGTCTAGCAGAGGCGGTGG + Intergenic
1059744198 9:117184237-117184259 CTCCCCTGGAGCAGAGCCGGGGG + Intronic
1060939974 9:127537615-127537637 CTGCTGGCGCCCAGAGCCGTTGG + Intronic
1061973302 9:134056089-134056111 CTGGTGCCAAGCAGAGCCTGGGG - Intronic
1200063089 X:153492211-153492233 TTGCTAGCGAGCAGAGCTGGCGG - Intronic