ID: 1063948308

View in Genome Browser
Species Human (GRCh38)
Location 10:11199050-11199072
Sequence CCTTAGGAGGAGGGGTTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063948295_1063948308 23 Left 1063948295 10:11199004-11199026 CCTTGTATAGACCAAGAGTAGTT 0: 1
1: 0
2: 1
3: 7
4: 110
Right 1063948308 10:11199050-11199072 CCTTAGGAGGAGGGGTTGGTAGG No data
1063948294_1063948308 28 Left 1063948294 10:11198999-11199021 CCTGGCCTTGTATAGACCAAGAG No data
Right 1063948308 10:11199050-11199072 CCTTAGGAGGAGGGGTTGGTAGG No data
1063948296_1063948308 12 Left 1063948296 10:11199015-11199037 CCAAGAGTAGTTGACTTTCCAGG No data
Right 1063948308 10:11199050-11199072 CCTTAGGAGGAGGGGTTGGTAGG No data
1063948299_1063948308 -6 Left 1063948299 10:11199033-11199055 CCAGGTAACCATGGATACCTTAG 0: 1
1: 0
2: 0
3: 11
4: 84
Right 1063948308 10:11199050-11199072 CCTTAGGAGGAGGGGTTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063948308 Original CRISPR CCTTAGGAGGAGGGGTTGGT AGG Intronic
No off target data available for this crispr