ID: 1063949551

View in Genome Browser
Species Human (GRCh38)
Location 10:11209288-11209310
Sequence CCACGCAGTGCTTGCTTTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 143}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063949551_1063949554 -8 Left 1063949551 10:11209288-11209310 CCTAGAAAGCAAGCACTGCGTGG 0: 1
1: 0
2: 2
3: 8
4: 143
Right 1063949554 10:11209303-11209325 CTGCGTGGAGGTCCAGCCACAGG No data
1063949551_1063949558 8 Left 1063949551 10:11209288-11209310 CCTAGAAAGCAAGCACTGCGTGG 0: 1
1: 0
2: 2
3: 8
4: 143
Right 1063949558 10:11209319-11209341 CCACAGGAATTCACACCAACGGG No data
1063949551_1063949559 19 Left 1063949551 10:11209288-11209310 CCTAGAAAGCAAGCACTGCGTGG 0: 1
1: 0
2: 2
3: 8
4: 143
Right 1063949559 10:11209330-11209352 CACACCAACGGGCCCAGAGTCGG No data
1063949551_1063949556 7 Left 1063949551 10:11209288-11209310 CCTAGAAAGCAAGCACTGCGTGG 0: 1
1: 0
2: 2
3: 8
4: 143
Right 1063949556 10:11209318-11209340 GCCACAGGAATTCACACCAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063949551 Original CRISPR CCACGCAGTGCTTGCTTTCT AGG (reversed) Intronic
905324482 1:37141041-37141063 ACACTCTGTGCTTGTTTTCTTGG - Intergenic
905752292 1:40476935-40476957 AAACGCAGTTCCTGCTTTCTTGG - Intergenic
909334416 1:74455000-74455022 CCACTGAGTTCTTTCTTTCTGGG + Intronic
910181076 1:84483996-84484018 CCACCCAGAGCTTACATTCTAGG + Intronic
914994745 1:152533674-152533696 CCAGGCAGTGCTTGGTGTCCAGG + Intronic
915731495 1:158057301-158057323 CAAGGCAGGGCTTCCTTTCTGGG - Intronic
916825877 1:168441441-168441463 CCACGCAGTCTTTGCTGTCAAGG + Intergenic
1063139832 10:3246053-3246075 GCTCTCAGTGCTTACTTTCTGGG - Intergenic
1063949551 10:11209288-11209310 CCACGCAGTGCTTGCTTTCTAGG - Intronic
1064335543 10:14437353-14437375 CCACGCAGGGCCAGCTTCCTAGG - Intronic
1066436271 10:35398956-35398978 ATACGCCGTGCTTGCTTTCCTGG + Intronic
1069952759 10:72031009-72031031 CCACGCAGTGCTGGAACTCTGGG + Intergenic
1070368077 10:75755679-75755701 CTTTGCATTGCTTGCTTTCTTGG - Intronic
1070425994 10:76287922-76287944 TGACTCAGTGCTTGTTTTCTGGG - Intronic
1080107911 11:28530521-28530543 CCAAGCAGGGCTTTCTTTTTTGG - Intergenic
1083820628 11:65169467-65169489 CCACTCACTACTTCCTTTCTAGG + Intergenic
1083936344 11:65871970-65871992 CCCGGCAGTGCTGGCTGTCTGGG + Exonic
1087012628 11:93528465-93528487 CCCCAGAGTTCTTGCTTTCTGGG - Intronic
1087400773 11:97664550-97664572 CAGAGCAGTGCTTGGTTTCTTGG - Intergenic
1087833324 11:102843809-102843831 CCAGGAAGTGCTTCCTGTCTTGG + Intergenic
1089017927 11:115182121-115182143 CCATGAAGTGCTGGCTTTCCTGG + Intronic
1089180021 11:116577124-116577146 CCATGCTGTGCTTGCTGTCTTGG + Intergenic
1090744428 11:129695051-129695073 CCAGGCAGAGCCTGCATTCTTGG - Intergenic
1090990064 11:131809289-131809311 CCCCGCACTGCCAGCTTTCTTGG + Intronic
1091613655 12:2032939-2032961 CCCTCCAGTGCTTGCTTTCGAGG + Intronic
1094161561 12:27396233-27396255 TCATGCAGTGCTTGGCTTCTAGG + Intronic
1098874112 12:75849019-75849041 CCACGCTGAGCTAGCTTGCTAGG + Intergenic
1103247545 12:119470924-119470946 ACACACATTGCTTGCTTACTAGG + Intronic
1108470880 13:50765857-50765879 CCACGCAATGCAAGTTTTCTTGG - Intronic
1108865003 13:54912226-54912248 CCACCCAGTGTATTCTTTCTTGG + Intergenic
1110828498 13:80001657-80001679 ACACACAATGCTTTCTTTCTGGG + Intergenic
1113539937 13:111099036-111099058 CCAACCAGTGATTGCTATCTTGG - Intergenic
1115582875 14:34779008-34779030 CCATGCCCAGCTTGCTTTCTGGG + Intronic
1115789616 14:36864490-36864512 CTACGCAGTACTTTCTTGCTTGG + Intronic
1117240647 14:53829221-53829243 GAAAACAGTGCTTGCTTTCTCGG + Intergenic
1121178996 14:91913488-91913510 CCACTCAGTGCCTGTTTTCCAGG + Intronic
1127925443 15:63535928-63535950 CCACACATTGGCTGCTTTCTAGG + Intronic
1128756822 15:70188914-70188936 CTGTGCTGTGCTTGCTTTCTTGG + Intergenic
1129207185 15:74044252-74044274 CCACGCGGAACTTGCTTTCCCGG - Exonic
1130889816 15:88124288-88124310 CCAGGCAGACCTTCCTTTCTTGG - Intronic
1134875846 16:17697872-17697894 CCCCACAGTACTTTCTTTCTTGG - Intergenic
1135147940 16:19979385-19979407 CCACCCAGTGTGTGCCTTCTGGG - Intergenic
1135753010 16:25071958-25071980 TCCTGCAGTGCTTGCTTTCTTGG + Intergenic
1136138946 16:28276458-28276480 CCAGGCAGTGTTGGCTTGCTTGG + Intergenic
1137352952 16:47730179-47730201 CCACGCAGTGACTGCTCTCAAGG - Intergenic
1140139362 16:72240377-72240399 GCAAGCAGCGCTTGCTTTCTTGG + Intergenic
1140674863 16:77317982-77318004 CGACATAGTGCTTGTTTTCTGGG - Intronic
1142237138 16:88927672-88927694 CCAGGCAGTGCTGGCTTCCCCGG - Intronic
1143145792 17:4774339-4774361 GCAGGCAGTGCTTGCTCTCGTGG - Intronic
1143705475 17:8695008-8695030 CCACATGCTGCTTGCTTTCTGGG + Intergenic
1147903200 17:43804035-43804057 ACAGGCAGTGCCAGCTTTCTAGG - Intronic
1148399546 17:47343669-47343691 CCACCTAGTGCTTGCCTTTTTGG + Intronic
1150435600 17:65151966-65151988 CCAGGAAGAGCTTGCTTTCCAGG + Intronic
1151886572 17:76926275-76926297 CCAAGCAGTGCCTCCCTTCTGGG + Intronic
1152376336 17:79920646-79920668 CCATGCAGTGCCTGCATTTTAGG + Intergenic
1153523037 18:5969598-5969620 CACAGCAGTGCTTGCTCTCTGGG - Intronic
1153945662 18:10015119-10015141 CCACCAAGGGCTTGCTGTCTGGG - Intergenic
1155146434 18:23087756-23087778 CCTGGCAGTGTCTGCTTTCTGGG - Intergenic
1161477498 19:4494567-4494589 CCACGCACTGCTTTCTTGATGGG - Intronic
1165212070 19:34243892-34243914 CCCAGCATTGCTTGCTTTATCGG - Intergenic
1166560947 19:43731948-43731970 CCACACAGTGCTGGCTTTGTGGG + Intronic
1168273483 19:55263007-55263029 CCTCTCAGTGCTTTCTTTCATGG - Intronic
928126893 2:28622950-28622972 CCACGAAGAGCTTGCACTCTAGG + Intronic
929325611 2:40607069-40607091 CCACCCAGTGATTCATTTCTTGG - Intronic
929458964 2:42087180-42087202 CCAAGCGGTGTTTGCTTTCAAGG - Intergenic
932214464 2:69958043-69958065 CCACAGAGGGCTTGCTGTCTGGG - Intergenic
933993979 2:87654428-87654450 CCACCCACTGCTTTCTTTATTGG + Intergenic
935121901 2:100190563-100190585 GCACGCAGGGCTGGGTTTCTAGG - Intergenic
935643583 2:105313428-105313450 GGACCCAGTGCTTGCTTTGTAGG - Intronic
936262494 2:110973877-110973899 CCAGGCAGTGCTTGGTCCCTTGG + Intronic
936299884 2:111296486-111296508 CCACCCACTGCTTTCTTTATTGG - Intergenic
937336424 2:121065163-121065185 GGACACAGTCCTTGCTTTCTGGG - Intergenic
937487805 2:122334150-122334172 TCACGCAGTCATTGGTTTCTAGG + Intergenic
942785255 2:179693727-179693749 ACAGGCAGTTATTGCTTTCTTGG - Intronic
943812733 2:192209645-192209667 CCTCACAGAGCTTGCTTTCATGG - Intergenic
947503711 2:230690991-230691013 CCAGGCAGTGCCTGCTGGCTGGG - Intergenic
947624058 2:231608387-231608409 CCTCTCAGAGCTGGCTTTCTAGG + Intergenic
948027195 2:234787511-234787533 CCCCCAAGTGCTTGTTTTCTGGG + Intergenic
948164093 2:235848048-235848070 CTAGGCACTGCTTGGTTTCTGGG + Intronic
948547526 2:238743355-238743377 CCGCCCAGCGCTTGCTCTCTTGG + Intergenic
1169972663 20:11285921-11285943 CCATGGGGTGCTTTCTTTCTGGG + Intergenic
1173339680 20:42142002-42142024 CCACTCTGTCCTTGCTTTTTAGG - Exonic
1177805427 21:25870273-25870295 TCACGCAGTGCCAGCTTTGTGGG + Intergenic
1178410572 21:32360248-32360270 CCACAAAATGCTTGCTGTCTGGG - Intronic
1178737637 21:35167137-35167159 TCACGCAGTGTCTGCTGTCTGGG + Intronic
1178904160 21:36622872-36622894 CCGTGCAGAGCTTGCTTTTTTGG + Intergenic
1184613872 22:45624738-45624760 ACACCCTGTGCTTGTTTTCTTGG + Intergenic
1184840910 22:47051956-47051978 TCTCACAGTGTTTGCTTTCTCGG + Intronic
1185319385 22:50193513-50193535 CCACGGAGCCCTGGCTTTCTGGG + Intronic
950497301 3:13341423-13341445 CCACCCAGTCAGTGCTTTCTGGG + Intronic
951154959 3:19340826-19340848 AAACTCAGTGCTTGCCTTCTTGG + Intronic
953035011 3:39203637-39203659 CCAGTCAGAGCTGGCTTTCTGGG + Intergenic
953420128 3:42747838-42747860 CCACGCTGGGCTTGCCTTCGGGG - Intronic
954365631 3:50144682-50144704 CCACGCAGTCCCATCTTTCTTGG + Intergenic
954579615 3:51696214-51696236 CCACACACTGCTGGCTGTCTGGG + Intronic
955744558 3:62127167-62127189 CCAGGCAGTGATCTCTTTCTGGG + Intronic
956660313 3:71590972-71590994 CCGCCCTGTGCTTGCTTTCCTGG - Intergenic
959727571 3:109561245-109561267 GAATGCTGTGCTTGCTTTCTTGG - Intergenic
962343199 3:134602108-134602130 CCAGGCAGTGCTGGCTCTCAGGG + Intronic
966336553 3:178874336-178874358 CCTCCCAGTTCTTCCTTTCTGGG - Intergenic
966872068 3:184297339-184297361 CCACTCAGTGCTTGGATTCTAGG - Intronic
968976623 4:3825429-3825451 CCACGCAGTGCTTTCATTCTGGG - Intergenic
970628909 4:17920224-17920246 CCAAGCAGTGCTTACTACCTGGG - Intronic
975499754 4:75071565-75071587 CAACGCAGTGTTTTCTTTGTTGG - Intergenic
975508976 4:75171328-75171350 CCAGGTTGTGCTTGCTTTCTGGG + Intergenic
977139413 4:93348934-93348956 CCAGGCAGGGCCTGCCTTCTTGG + Intronic
977639891 4:99345186-99345208 TCAAGCAGTAGTTGCTTTCTGGG + Exonic
978826111 4:113026009-113026031 CCAAGAATTGCTTGCTTTCTTGG + Intronic
979218602 4:118194754-118194776 CCACGCAGCGCACCCTTTCTGGG + Intronic
982420012 4:155183764-155183786 CTGCACAGTGCTTGCTTACTGGG + Intergenic
983971363 4:173878888-173878910 ACACGCAGGGCTAGCTTTCTTGG + Intergenic
985364365 4:189211499-189211521 TCATACAGTGCTTGATTTCTTGG + Intergenic
987028473 5:13952454-13952476 CCACCAAGTGCTCTCTTTCTGGG - Intergenic
992242051 5:74781899-74781921 CCAAGATGTGCTTTCTTTCTTGG + Exonic
998445906 5:142198195-142198217 CCACACAATCCTTGCTGTCTTGG + Intergenic
1000518135 5:162265602-162265624 CCTTGCAGTAATTGCTTTCTTGG + Intergenic
1002279738 5:178123294-178123316 CCATGCATTGCGTGCTTACTGGG + Exonic
1007364717 6:41383366-41383388 CCTCACAGGGCTTGCATTCTAGG + Intergenic
1010085828 6:71916949-71916971 CCTCACAGAGCTTGCATTCTGGG + Intronic
1011017119 6:82769131-82769153 CCACAAAGTCCTTGCTTTGTAGG - Intergenic
1016093790 6:140011607-140011629 TCACCCACTGTTTGCTTTCTAGG - Intergenic
1016545539 6:145219052-145219074 CCTCGCAATGCTAGCTTCCTTGG - Intergenic
1018242136 6:161788042-161788064 CCACGCAGCCATGGCTTTCTGGG - Intronic
1021342263 7:19479675-19479697 CCACCCAGTTCTAGCTTCCTGGG + Intergenic
1024645839 7:51369594-51369616 CCAAGCAGTTCTTGCTGGCTTGG + Intergenic
1025036698 7:55597711-55597733 CCAAGCAGTTCTTGCTGGCTTGG + Intergenic
1026591613 7:71700880-71700902 TGACACAGTGCTTGCTTTCGAGG - Intronic
1030628577 7:111870616-111870638 CCAGCCAGTTCTTGGTTTCTAGG + Intronic
1030976895 7:116137372-116137394 ACACACAGTGCCAGCTTTCTGGG + Intronic
1033004981 7:137551815-137551837 CAACTCAGTGTTGGCTTTCTGGG - Intronic
1033584894 7:142767082-142767104 CCACCCAGCACTTGCTTTATTGG - Intergenic
1036077781 8:5520691-5520713 CCACGCAGATCTTGATCTCTGGG - Intergenic
1037388856 8:18371292-18371314 CCAAGCAGTGCATACCTTCTGGG - Intergenic
1037602142 8:20406177-20406199 CCCCGCACTGCCTGCTGTCTTGG + Intergenic
1040583238 8:48714820-48714842 TAACACAGTGCTTACTTTCTTGG - Intronic
1041016149 8:53594677-53594699 CCCCGCAGTGCCTGATTTCCCGG - Intergenic
1046611047 8:116426117-116426139 CTAGGCTGTGCTTGCTTTGTGGG - Intergenic
1047116691 8:121850255-121850277 CCTCCCAGTGTTTACTTTCTTGG + Intergenic
1048007426 8:130430842-130430864 TCCCGAAGTCCTTGCTTTCTAGG - Intronic
1048377452 8:133835024-133835046 CCACCCAGGGCTGGCTTTGTGGG - Intergenic
1051145572 9:14023753-14023775 CTACCCAGGGCTTGCTTTCATGG - Intergenic
1052802403 9:32981485-32981507 CCAGGGTGTCCTTGCTTTCTAGG - Intronic
1057417625 9:94878888-94878910 TCACGCAGAGCTGGCTTTGTGGG + Intronic
1061031649 9:128088154-128088176 CCTTGCAGGGCTTGCTTTGTTGG + Intronic
1185586072 X:1242974-1242996 CCACTCAGTGCTTGCTTTCGGGG + Intergenic
1186799582 X:13079438-13079460 CCAGGCAGTGCTTGCTGGCAGGG - Intergenic
1187241753 X:17520385-17520407 CCCTACAGAGCTTGCTTTCTTGG - Intronic
1188527564 X:31102633-31102655 CCAGGCAGTGCCTGCTTCTTTGG + Intronic
1189974759 X:46449604-46449626 TCACACTGCGCTTGCTTTCTTGG + Intronic
1192222644 X:69207775-69207797 CCACACAGTGCCTGGTGTCTGGG - Intergenic
1194040661 X:88938414-88938436 CCACACAGGGCTTCCTATCTTGG - Intergenic
1194094515 X:89620803-89620825 ACACGCAGTGTTTGGTTTTTTGG - Intergenic
1199051466 X:143241225-143241247 CCAAGAAGTGATTGCTTTATAGG - Intergenic
1199348702 X:146774262-146774284 ACACCCAGTGGTTGCATTCTTGG + Intergenic