ID: 1063949555

View in Genome Browser
Species Human (GRCh38)
Location 10:11209315-11209337
Sequence TTGGTGTGAATTCCTGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 179}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063949555_1063949559 -8 Left 1063949555 10:11209315-11209337 CCAGCCACAGGAATTCACACCAA 0: 1
1: 0
2: 1
3: 15
4: 179
Right 1063949559 10:11209330-11209352 CACACCAACGGGCCCAGAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063949555 Original CRISPR TTGGTGTGAATTCCTGTGGC TGG (reversed) Intronic
904448473 1:30595456-30595478 TGATTGTGGATTCCTGTGGCAGG - Intergenic
904796272 1:33058574-33058596 TTGGTGAGTTTTCCAGTGGCCGG + Intronic
905547107 1:38808606-38808628 TTGTGGTGCATGCCTGTGGCAGG - Intergenic
908260783 1:62338095-62338117 TTGGTTCAAATTCCTGAGGCAGG + Intergenic
911502152 1:98700689-98700711 TAGGTGTGAACTACTGTGCCTGG + Intronic
911530896 1:99041591-99041613 TTGGTGTGTTTTGCAGTGGCTGG - Intergenic
912935414 1:113999855-113999877 TTTGTTTGCATTTCTGTGGCAGG + Intergenic
913044043 1:115058238-115058260 TAGCTGTGAATTCCTGGGCCAGG - Intronic
915035728 1:152922433-152922455 TTAGTGTTAGTTCCTGTGCCTGG + Intergenic
916115541 1:161482101-161482123 AAGGTGTCCATTCCTGTGGCCGG - Intergenic
916309611 1:163381737-163381759 CTCGTGTGAAGTCCTGAGGCAGG - Intergenic
917060358 1:171031393-171031415 TTGGTGTGTTTTCCAGTGGCTGG + Intronic
917531030 1:175835094-175835116 TTGGTGTGACTGGCTGGGGCTGG - Intergenic
918378343 1:183931286-183931308 TTTGTGGGAATTCATGTGACTGG - Intronic
919078658 1:192842904-192842926 TTGCTGTGAATTGCTATGGTGGG + Intergenic
919095614 1:193032016-193032038 TTGGTTTGAATTCCTACGCCAGG + Intronic
919925105 1:202188116-202188138 TTGGCCAGAATTCCTGTGGCTGG - Intergenic
921353139 1:214257991-214258013 TTAGTGCCAATTCTTGTGGCCGG - Intergenic
924545211 1:245020116-245020138 TTGGTGTTACTTCCTGTGTAGGG + Intronic
1063255909 10:4326940-4326962 CCACTGTGAATTCCTGTGGCTGG + Intergenic
1063949555 10:11209315-11209337 TTGGTGTGAATTCCTGTGGCTGG - Intronic
1063994340 10:11604019-11604041 TTGGTCTGAATTCCTAGAGCTGG - Intronic
1064493644 10:15885591-15885613 TTGGAGTCAATACCTGTGGAAGG + Intergenic
1066444398 10:35468753-35468775 TTGGTGTGAATTTCTTTTCCAGG + Intronic
1067349691 10:45464824-45464846 TTTGTGTGAAGAGCTGTGGCAGG - Intronic
1067393847 10:45892988-45893010 TTGTTCAGAATTTCTGTGGCAGG - Intergenic
1069139721 10:64808557-64808579 TTGGTATGTTTTCCAGTGGCTGG + Intergenic
1071490622 10:86134157-86134179 CTGGTGGGCATTCCAGTGGCTGG - Intronic
1075045010 10:119139791-119139813 GTGGTGTCAATTCCTGAGACTGG + Intergenic
1075975361 10:126689553-126689575 CTGGTGTGAGGTCCTGTGGTGGG - Intergenic
1076343099 10:129763343-129763365 TTTGTGTGAATTTTGGTGGCAGG - Intronic
1076941984 10:133616023-133616045 TGGCTGTGAATACCTGTGCCGGG - Intergenic
1079394265 11:20048622-20048644 TTGGTGAGAATTCCTGGGGAAGG - Intronic
1079404323 11:20131624-20131646 CTGGTGTGGATTCGTGTGCCTGG + Intergenic
1080502774 11:32886196-32886218 ATTGTGTAAATTCCTGAGGCCGG - Intergenic
1081759870 11:45569717-45569739 TTGGTGTTTCTTCCTGAGGCTGG - Intergenic
1081991829 11:47342202-47342224 GTGGCGTGAATCCCTGTGGAGGG + Intronic
1083458242 11:62793432-62793454 TAGGTGTGAGTTACTGTGCCTGG - Intronic
1084017906 11:66397474-66397496 TAGGTGTGAATCACTGTGACTGG + Intergenic
1084134005 11:67161082-67161104 CAGGTGTGAATTACTGTGCCTGG - Intronic
1086033927 11:82393993-82394015 TTTGTGTGAATTCCTAGGGGAGG - Intergenic
1087316811 11:96613224-96613246 TTGGTGTGTTTTGCAGTGGCTGG + Intergenic
1089324663 11:117648872-117648894 TTGGTCTGATTCTCTGTGGCAGG - Intronic
1089375399 11:117990299-117990321 TTGGTCTGAATTTCTGAGGCTGG - Intronic
1089526548 11:119100982-119101004 TGGGGGTGATTGCCTGTGGCTGG - Intronic
1092410364 12:8248205-8248227 TAGGTGTGAGCCCCTGTGGCTGG + Intergenic
1094283918 12:28770923-28770945 ATGGTGTGATTTCATGTGGCAGG + Intergenic
1094504302 12:31048451-31048473 GTGGCGTGAGTTGCTGTGGCTGG - Intergenic
1094625189 12:32116855-32116877 TAGGTGTGAACTACTGTGCCTGG + Intronic
1095783693 12:46087368-46087390 TGGGTGTGACTGCCTGGGGCTGG + Intergenic
1096324252 12:50644728-50644750 TTGCTGTGAATGCCTGTGACAGG + Intronic
1096966726 12:55633792-55633814 TTGTTTTGGATTCCTGTAGCTGG - Intergenic
1097851366 12:64413396-64413418 TAGGTGTGAACTGCTGTGCCTGG + Intronic
1098902717 12:76129643-76129665 TTCATGTTAATTTCTGTGGCTGG + Intergenic
1098937317 12:76495366-76495388 TTGGACTGAATTCCTTTGGGAGG - Intronic
1100219303 12:92486721-92486743 TCCGTGTGAAATTCTGTGGCTGG + Intergenic
1100951107 12:99851199-99851221 TTGGTTAGGTTTCCTGTGGCAGG + Intronic
1104213145 12:126709984-126710006 TTGGTGTGAATTCAAGTTGGGGG + Intergenic
1105598948 13:21868150-21868172 TTTGTGTGATGTCCTGGGGCTGG + Intergenic
1111501045 13:89120172-89120194 GAGGTGTGAATTCTTGTGGAAGG - Intergenic
1114317189 14:21520179-21520201 TAGGCGTGAATCACTGTGGCTGG + Intergenic
1116113001 14:40610784-40610806 TTGGTATGATTTGCAGTGGCTGG + Intergenic
1116866565 14:50036371-50036393 TTTGTGTGATTCCCTGCGGCAGG + Intergenic
1118672182 14:68140791-68140813 ATGGTGTGAATTAATGTGCCAGG + Intronic
1119306812 14:73614349-73614371 GTACTGTGAATTCCTGGGGCTGG + Intronic
1121334067 14:93066243-93066265 TTGGTGTGTCCTCCTGAGGCTGG - Intronic
1122222814 14:100251903-100251925 CAGGTGTGAACTCCTGTGCCTGG + Intronic
1124699944 15:31904088-31904110 ATGGGATGAATTTCTGTGGCAGG - Intergenic
1124817937 15:33015358-33015380 ATGGTGTGAATTTCAATGGCTGG + Intronic
1126800015 15:52289716-52289738 TTGATTGGAATTCCTGTGGGTGG + Intronic
1127482126 15:59387396-59387418 CTGGTGCGAATGCCTCTGGCAGG + Intronic
1136250866 16:29004092-29004114 TTGGTGAGAATTTGTGTGCCAGG + Intergenic
1137758492 16:50921234-50921256 TTTTTGTGAATTCATGTAGCAGG - Intergenic
1138254143 16:55538129-55538151 TTGGTTTGAATTACAGTGGCAGG + Intronic
1140191149 16:72818031-72818053 TTGCTGTAAATTTCTGGGGCAGG - Intronic
1141331676 16:83116821-83116843 TTGGAGTCAATTTCTCTGGCTGG - Intronic
1143562387 17:7703666-7703688 TTGGTGTGAAGTCAAGTGGGTGG + Intergenic
1143726027 17:8847221-8847243 TAGGTGTGACTTTCTGTGGTTGG - Intronic
1144515997 17:15917844-15917866 TTGGGGTGGCCTCCTGTGGCAGG - Intergenic
1146365271 17:32219757-32219779 TAGGTGAAAATTCCTGTGTCTGG - Intronic
1146736756 17:35244555-35244577 GAGGTGAGAGTTCCTGTGGCAGG + Intronic
1147368111 17:39972851-39972873 TAGGTGTGAATCACTGTGCCTGG - Intronic
1151515231 17:74589852-74589874 CTGGGGGCAATTCCTGTGGCAGG + Intronic
1153702842 18:7713399-7713421 TTGGTATGATTTGCAGTGGCTGG - Intronic
1153786331 18:8538293-8538315 TTAGTGTGCTTACCTGTGGCAGG - Intergenic
1154995710 18:21638317-21638339 ATGGTGTGAATTCCAGTGTAAGG + Intergenic
1159106467 18:64006562-64006584 TTGGTTTGCATTCTTGAGGCTGG - Intergenic
1160240520 18:77119325-77119347 TGGGTGTGCTCTCCTGTGGCAGG - Intronic
1162240124 19:9344816-9344838 TTGGTTTGAATTATTGAGGCAGG + Intronic
1162334697 19:10053083-10053105 TGGGTGTTAATGCCTGAGGCGGG - Intergenic
1162738467 19:12759938-12759960 TTGATGTGATGGCCTGTGGCGGG - Intergenic
1165495672 19:36150976-36150998 TTGGTCTTAATTCCTGGGGAAGG + Exonic
1166836204 19:45669395-45669417 TGTGTGTGAATCCCTGAGGCGGG + Intronic
925903158 2:8522932-8522954 CTGGTGTGAATTTCTGGGGTGGG - Intergenic
928925573 2:36575503-36575525 GTGGAGTGCTTTCCTGTGGCAGG - Intronic
932441958 2:71743210-71743232 CAGGTCTGAATTCCTGTGGAAGG - Intergenic
934021392 2:87957315-87957337 TTGCTGTGTCTTCATGTGGCTGG - Intergenic
934187894 2:89762994-89763016 TTGGCGTGAAGTTCTGTGGAGGG + Intergenic
940340215 2:152572348-152572370 TTGGTTTGATTTCCTGTGGCTGG + Intronic
942441819 2:176044695-176044717 TAGGTGTGAACCCCTGTGCCTGG + Intergenic
942809790 2:179984531-179984553 TTGGTCAAAATTCCTGTGGGGGG + Intronic
942924294 2:181413148-181413170 TTGGTGTGTTTTGCAGTGGCTGG - Intergenic
945314705 2:208359757-208359779 CAGGTGTGAGTTCCTGTGGGAGG - Intronic
946456728 2:219832535-219832557 CTGGTGTGTATTCCTTTGTCTGG - Intergenic
946488305 2:220122211-220122233 TTCCTGTGCATACCTGTGGCAGG + Intergenic
948294535 2:236850729-236850751 TTGGTGGGAGATCATGTGGCTGG + Intergenic
948777823 2:240299063-240299085 TTGGTCTGGAATCCTGTGGATGG + Intergenic
948852802 2:240716656-240716678 GTGGTGTGAGTTCCTCTGGTGGG - Exonic
1170925532 20:20719605-20719627 TTGGTGTGAGTCACTGTGCCTGG - Intergenic
1171010919 20:21509015-21509037 TGGGTGTGCGCTCCTGTGGCCGG - Intergenic
1171404217 20:24898989-24899011 TTGGTGTGATTTCCTCTGATTGG - Intergenic
1171404277 20:24899468-24899490 TTGGTGTGATTTCCTCTGATTGG - Intergenic
1172861884 20:38060740-38060762 GTGGGGTGAATTCCTGGGGTGGG - Intronic
1173592348 20:44234615-44234637 TGGGTTTGCATTCCAGTGGCTGG + Intergenic
1179266940 21:39812283-39812305 TGAGTGTGAACCCCTGTGGCTGG - Intergenic
1181479363 22:23188420-23188442 TTGGTTGGAAGTCCTGTGGCTGG + Intronic
1182639483 22:31754840-31754862 TTCGTTTGTATTTCTGTGGCAGG + Exonic
1184190046 22:42888297-42888319 TGGGTGTGAATGGGTGTGGCTGG - Intronic
1185186129 22:49401513-49401535 TGGGTGGGAATTCCTGTGCCTGG - Intergenic
951120250 3:18918249-18918271 TTTGGGTGAATCCCTGTGGAGGG - Intergenic
952149088 3:30567015-30567037 TTGGTGTTAATGCCTGAGGTGGG - Intergenic
952641706 3:35604373-35604395 TTGGGGTGAACTCCTGTGAAGGG - Intergenic
954586232 3:51739173-51739195 TTTGTGTTAATTCCAGAGGCAGG + Intergenic
956159530 3:66334591-66334613 TAGGTGTGAATTACTGCGCCGGG + Intronic
958764760 3:98353611-98353633 TCTGTGTGAATTCCTAGGGCAGG - Intergenic
959317915 3:104832834-104832856 TTGGTGTCTCTTCCTTTGGCTGG - Intergenic
961137063 3:124521016-124521038 TTGATGTGAACACCTGTGGGAGG - Intronic
961192493 3:124973711-124973733 TCGGTGTGTATTCCTGTGTCAGG - Exonic
965207729 3:165743541-165743563 CTAGTGTGAAATCCTGTGGAAGG - Intergenic
965315935 3:167190759-167190781 TTGGTGTGAATTTCAGTGAATGG - Intergenic
966472925 3:180312104-180312126 TGGTTGTAATTTCCTGTGGCTGG - Intergenic
967108081 3:186269939-186269961 TTGGTGAGAATTCCAGGGGGAGG - Intronic
968013117 3:195300339-195300361 TCTGTCTGAAATCCTGTGGCCGG - Intronic
969881711 4:10179774-10179796 ATGGTGTGAATTGCTCTGGGTGG + Intergenic
972409523 4:38778890-38778912 TTTGTGTGCATTCCTGTGGATGG - Intronic
972947734 4:44278361-44278383 TTTCTGTCTATTCCTGTGGCAGG + Intronic
973791325 4:54380720-54380742 TAGGCGTGAATCACTGTGGCAGG + Intergenic
977678681 4:99774741-99774763 TTGGTGTTACTTCCAGGGGCAGG + Intergenic
978106503 4:104907794-104907816 TTGGTGTGAATCATAGTGGCTGG - Intergenic
979121229 4:116904739-116904761 TTAGTGTGAAGCCCTGTGGAAGG + Intergenic
980291312 4:130850063-130850085 TTGGTGTGTTTTTCTGTGGGTGG - Intergenic
981235036 4:142405791-142405813 TTGGTGTGTATTACTGTGGGAGG - Intronic
981373402 4:143986505-143986527 TTGGTGTCATTTCCTGCAGCAGG + Intergenic
982475672 4:155847442-155847464 CAGGTGTGAATTCCTGTGCCTGG - Intronic
990313722 5:54564907-54564929 TTGGTCCGAATTCATGTGGGAGG + Intergenic
990977693 5:61573759-61573781 TTGGTTTGATTTTCTGTGGAAGG - Intergenic
991134876 5:63169900-63169922 TTGGTGTGATTCCCGTTGGCAGG - Intergenic
994731586 5:103498322-103498344 TTGGTGTGGTTTCCTGTTCCGGG - Intergenic
998927226 5:147140068-147140090 TTGGTGTGTTTTGCAGTGGCTGG + Intergenic
999330075 5:150667483-150667505 CTGGTGCCAATTCCTCTGGCTGG + Intronic
999350537 5:150866214-150866236 TGGCTAGGAATTCCTGTGGCAGG + Intronic
1003395769 6:5750701-5750723 TTGGTGTGAATGCAGGAGGCGGG + Intronic
1004002463 6:11607718-11607740 GTGGTGTGAATTCCTGCCCCTGG + Intergenic
1004496769 6:16171751-16171773 TTGCTGTGACTTCCAATGGCAGG + Intergenic
1004523036 6:16380400-16380422 TTCTTGTGAGTTCCTGTGTCTGG + Intronic
1007725314 6:43912568-43912590 TGGGTGAGAATCCCTGTGCCTGG + Intergenic
1009899616 6:69796216-69796238 TTGGTGTAGATACCTGTGGAGGG - Intronic
1011857794 6:91716532-91716554 TTGGTTTGAATTCCAGTGGTTGG - Intergenic
1011919284 6:92550703-92550725 CTTGTGTTATTTCCTGTGGCAGG - Intergenic
1013313026 6:108915231-108915253 TAGGTGTGAGTTACTGTGCCTGG + Intronic
1015888533 6:137945790-137945812 TAGGTGTGTATCCCTGTGGGAGG + Intergenic
1017657920 6:156647628-156647650 TTGGTGTGAATCTCTGTCGCGGG - Intergenic
1018848766 6:167572927-167572949 TTCGGGTGAGTTCCTGGGGCGGG - Intergenic
1018919243 6:168159959-168159981 TTGGGGTGAACTCCTGGGGTTGG + Intergenic
1019489045 7:1302638-1302660 CAGGTGTGAACTGCTGTGGCCGG + Intergenic
1020365554 7:7377442-7377464 CTGCTGGGAATTCCTGGGGCAGG + Intronic
1022465429 7:30650043-30650065 CTGGTGTGAGGACCTGTGGCTGG + Intergenic
1023082793 7:36541208-36541230 TTGTTGTGAAATGCTGTTGCAGG - Intronic
1025931689 7:66000164-66000186 CAGGTGTGAGTTACTGTGGCTGG - Intergenic
1029852941 7:103483681-103483703 CTTGTGTGAAGTCCTTTGGCTGG + Exonic
1032186266 7:129729365-129729387 TTGGTGTGATTTCATGTTGTTGG + Intronic
1032694820 7:134325881-134325903 CTGGTGTGAATGCATGAGGCTGG + Intergenic
1032949836 7:136894811-136894833 TTTTTGTGAATTCCTGGGGATGG - Intronic
1034912789 7:155011310-155011332 CTGGAGTAACTTCCTGTGGCAGG - Intergenic
1036260749 8:7238255-7238277 TGTGTGTCAATTTCTGTGGCTGG + Intergenic
1036305857 8:7601276-7601298 TGTGTGTCAATTTCTGTGGCTGG - Intergenic
1036312785 8:7696799-7696821 TGTGTGTCAATTTCTGTGGCTGG + Intergenic
1036356705 8:8049273-8049295 TGTGTGTCAATTTCTGTGGCTGG - Intergenic
1038384533 8:27129862-27129884 TAGGTGTGAGCTCCTGTGCCCGG - Intergenic
1040610684 8:48978472-48978494 TTGGTTTGAATTCCAGAGCCTGG + Intergenic
1042512265 8:69624427-69624449 TTAATGTGAATTACTCTGGCTGG - Intronic
1044873031 8:96638804-96638826 TTGGTGTCCTTTCCTGGGGCAGG + Intergenic
1047275804 8:123403909-123403931 CTGGTGTGGCTTCCTGTGGATGG - Intronic
1047543334 8:125791857-125791879 TGGGTGTAAATTCCTATAGCTGG - Intergenic
1049611396 8:143557553-143557575 TTGCTTTCAATTCCTGTGGGTGG + Intronic
1055286644 9:74735661-74735683 TTGTTTTTAATTCCTGTTGCTGG + Intronic
1057075738 9:92137299-92137321 TTGGCCAGAATTCCTATGGCTGG - Intergenic
1058512907 9:105738997-105739019 TAGGTGTGAATCACTGTGCCTGG + Intronic
1059895341 9:118857620-118857642 TTCGTGTGTTTTCCAGTGGCTGG - Intergenic
1060493142 9:124099619-124099641 TGGGTGTGCATTTCTGTGGGGGG - Intergenic
1061359183 9:130130363-130130385 TTGGTGTGGGTTCCTGGGCCAGG + Intronic
1061456634 9:130702975-130702997 TATTTGTGAATTTCTGTGGCTGG + Intronic
1061733244 9:132633268-132633290 CTGGTGGGAATCCCTATGGCAGG + Intronic
1195737983 X:108033213-108033235 TTGGTGTGACTTCCTGGGAGAGG - Intergenic
1196187498 X:112760320-112760342 TTGGGCTGAAGTTCTGTGGCTGG + Intergenic
1200817281 Y:7546749-7546771 TTGGTTGTCATTCCTGTGGCTGG + Intergenic