ID: 1063949559

View in Genome Browser
Species Human (GRCh38)
Location 10:11209330-11209352
Sequence CACACCAACGGGCCCAGAGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063949555_1063949559 -8 Left 1063949555 10:11209315-11209337 CCAGCCACAGGAATTCACACCAA 0: 1
1: 0
2: 1
3: 15
4: 179
Right 1063949559 10:11209330-11209352 CACACCAACGGGCCCAGAGTCGG No data
1063949551_1063949559 19 Left 1063949551 10:11209288-11209310 CCTAGAAAGCAAGCACTGCGTGG 0: 1
1: 0
2: 2
3: 8
4: 143
Right 1063949559 10:11209330-11209352 CACACCAACGGGCCCAGAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063949559 Original CRISPR CACACCAACGGGCCCAGAGT CGG Intronic
No off target data available for this crispr