ID: 1063949829

View in Genome Browser
Species Human (GRCh38)
Location 10:11212191-11212213
Sequence AGGGGCCTGCTGCAGGGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 831
Summary {0: 1, 1: 1, 2: 8, 3: 84, 4: 737}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063949829_1063949845 11 Left 1063949829 10:11212191-11212213 CCACATCCCTGCAGCAGGCCCCT 0: 1
1: 1
2: 8
3: 84
4: 737
Right 1063949845 10:11212225-11212247 CAGGGTGACAGCTGGGAAATGGG No data
1063949829_1063949844 10 Left 1063949829 10:11212191-11212213 CCACATCCCTGCAGCAGGCCCCT 0: 1
1: 1
2: 8
3: 84
4: 737
Right 1063949844 10:11212224-11212246 GCAGGGTGACAGCTGGGAAATGG No data
1063949829_1063949847 19 Left 1063949829 10:11212191-11212213 CCACATCCCTGCAGCAGGCCCCT 0: 1
1: 1
2: 8
3: 84
4: 737
Right 1063949847 10:11212233-11212255 CAGCTGGGAAATGGGGAACCAGG No data
1063949829_1063949843 4 Left 1063949829 10:11212191-11212213 CCACATCCCTGCAGCAGGCCCCT 0: 1
1: 1
2: 8
3: 84
4: 737
Right 1063949843 10:11212218-11212240 AGGTAGGCAGGGTGACAGCTGGG No data
1063949829_1063949838 -7 Left 1063949829 10:11212191-11212213 CCACATCCCTGCAGCAGGCCCCT 0: 1
1: 1
2: 8
3: 84
4: 737
Right 1063949838 10:11212207-11212229 GGCCCCTGGGGAGGTAGGCAGGG No data
1063949829_1063949837 -8 Left 1063949829 10:11212191-11212213 CCACATCCCTGCAGCAGGCCCCT 0: 1
1: 1
2: 8
3: 84
4: 737
Right 1063949837 10:11212206-11212228 AGGCCCCTGGGGAGGTAGGCAGG No data
1063949829_1063949848 20 Left 1063949829 10:11212191-11212213 CCACATCCCTGCAGCAGGCCCCT 0: 1
1: 1
2: 8
3: 84
4: 737
Right 1063949848 10:11212234-11212256 AGCTGGGAAATGGGGAACCAGGG No data
1063949829_1063949846 12 Left 1063949829 10:11212191-11212213 CCACATCCCTGCAGCAGGCCCCT 0: 1
1: 1
2: 8
3: 84
4: 737
Right 1063949846 10:11212226-11212248 AGGGTGACAGCTGGGAAATGGGG No data
1063949829_1063949842 3 Left 1063949829 10:11212191-11212213 CCACATCCCTGCAGCAGGCCCCT 0: 1
1: 1
2: 8
3: 84
4: 737
Right 1063949842 10:11212217-11212239 GAGGTAGGCAGGGTGACAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063949829 Original CRISPR AGGGGCCTGCTGCAGGGATG TGG (reversed) Intronic
900115546 1:1026397-1026419 ATGGGGCTGCTCCAGGGAAGGGG + Intronic
900151092 1:1179706-1179728 AGTGGCCTGGTGCAGGGCAGGGG - Exonic
900649611 1:3724364-3724386 GGGGGTCTGGTACAGGGATGGGG - Intronic
900732151 1:4269095-4269117 AGGGCCCGGCTGCTGGGGTGCGG + Intergenic
900931717 1:5742160-5742182 AGGGACCTGCAGCAGGGGTGAGG - Intergenic
901023378 1:6266552-6266574 AGGGCCCTGCTACACAGATGTGG - Intronic
901037772 1:6346716-6346738 AGGAGGCTGCTGCAGTGATCAGG + Intronic
901533097 1:9865929-9865951 AAGGGGCAGCTGCAGGAATGGGG - Intronic
901692471 1:10982416-10982438 AGGGGCCTGGAGCAGGGTTCTGG - Intergenic
901702422 1:11052843-11052865 AGAGGCATGCACCAGGGATGGGG - Intergenic
901702801 1:11054459-11054481 AAGTGTCTGCTGCAGGGCTGAGG - Intergenic
901735233 1:11308208-11308230 AGGGGTGTGCCACAGGGATGGGG - Intergenic
901842907 1:11964931-11964953 CAGGGCCTGCTGGAGGAATGGGG + Intronic
902658930 1:17887923-17887945 AGGCGCCAGCTGCAGGGGGGAGG - Intergenic
902676380 1:18011393-18011415 TGGGGCCTGTTGCAGGGTGGGGG + Intergenic
902688802 1:18096787-18096809 AGGGGGCAGCTGGAGGGAGGTGG + Intergenic
903422626 1:23229460-23229482 AGTGGCCAGCTGCAGGGAGAAGG + Intergenic
903659048 1:24965790-24965812 GGGGGCCCTCTGCAGGGCTGGGG + Intergenic
903927396 1:26840398-26840420 AGGGGGCTGCTGGAAGGATTAGG - Intronic
904260330 1:29284168-29284190 AGGGGCCTGGAGCAGGCTTGTGG + Intronic
904429065 1:30450296-30450318 AGGAGCATGCAGGAGGGATGTGG + Intergenic
905404472 1:37723649-37723671 GGGGGCCTGCAGCCAGGATGTGG - Intronic
905655998 1:39686430-39686452 AGGGGCCTGCTACACGGTTCAGG + Intronic
905866797 1:41381261-41381283 GGGGGCCTGCAGCAGGGAGCAGG - Intronic
906150330 1:43583806-43583828 AGGGGCCTGGGGCAGGTAGGAGG - Intronic
906165239 1:43681233-43681255 AGGGGACGGCTTCAGGGAGGGGG - Intronic
906479073 1:46188631-46188653 AGGGGGGTGCTGGAGGGAAGTGG - Intergenic
906675350 1:47689065-47689087 AGGGGCCTCCCGGAGGCATGGGG + Intergenic
907270548 1:53288445-53288467 TGGGGCCTGCGGCATGGCTGGGG + Intronic
909181102 1:72425130-72425152 AGGGGCCTGTTGGGGGGTTGGGG - Intergenic
909430166 1:75578629-75578651 TGGGGGCAGGTGCAGGGATGGGG + Intronic
909858644 1:80575069-80575091 AGGTGCTTGCTGAAGGGAAGGGG - Intergenic
910041974 1:82863482-82863504 TGGGGCCTTCTTCAGGGAGGAGG - Intergenic
910437414 1:87219487-87219509 AAGGCCCTGCTGCAGAAATGAGG - Intergenic
911134967 1:94429741-94429763 AGAAGTTTGCTGCAGGGATGGGG + Intronic
911146703 1:94559372-94559394 TGGGGCCTGTTGCGGGGAGGGGG + Intergenic
911161338 1:94685515-94685537 AGGTCCATGCTGCAGGAATGGGG - Intergenic
911461940 1:98202477-98202499 AAGGAACTCCTGCAGGGATGTGG - Intergenic
912893731 1:113562673-113562695 TGGGGCCTGTTGGAGGGTTGCGG + Intronic
914049262 1:144118165-144118187 TGGGGCCTATTGCAGGGGTGGGG + Intergenic
914129922 1:144847280-144847302 TGGGGCCTATTGCAGGGGTGGGG - Intergenic
914440880 1:147705144-147705166 AGGGGCCTGTTGTGGGGTTGGGG - Intergenic
915305641 1:154975913-154975935 TGGGGCCTGCTTGAGGGAGGAGG + Intronic
915468072 1:156109373-156109395 AGGGGCCTGGTGCTGGGATGGGG - Intronic
915777060 1:158501511-158501533 AGAGGCCTGCTGCAGGGGTGGGG - Intergenic
915822579 1:159041063-159041085 AGGAGCCTGCTGCAGTGCTGTGG - Intronic
916216501 1:162399661-162399683 AGGGGCCTGTTGGAGGGCTCAGG - Intronic
916682305 1:167115821-167115843 TGAGCCCTGATGCAGGGATGTGG + Intronic
916695525 1:167232039-167232061 CAGGGCCTGCTGCAGGACTGAGG - Intronic
916724477 1:167510496-167510518 AGCTGCCTGCTGCAGGGAGAAGG - Intronic
917002047 1:170370998-170371020 CGGGGCCTGTTGCAGGGTGGGGG - Intergenic
917242523 1:172964167-172964189 TGGGGCCTGTTGGAGGGTTGGGG + Intergenic
917733682 1:177901167-177901189 AGAGGGCTGCAGCAGGAATGGGG - Intergenic
918224471 1:182468605-182468627 TGGGGCCTGTTGTAGGGTTGAGG + Intronic
918428237 1:184432507-184432529 TGGGGCCTGTTGCAGGGTAGGGG + Intronic
918466677 1:184827782-184827804 CGGGGCCTGCTTCAGGAAGGAGG - Intronic
918757677 1:188357947-188357969 AGAAGCCTGCTGCAGAGGTGGGG - Intergenic
919569830 1:199233975-199233997 AAGGGCCTGCTTCAGAGATGTGG - Intergenic
920192706 1:204203670-204203692 AGGTGCCTGCTGCAGGAGGGAGG - Intronic
920296301 1:204959281-204959303 AGGGGCTTGCTGCAGGTGTCAGG - Intronic
920333366 1:205228076-205228098 AGGGGCCGGTTGCAGGGCCGGGG + Intergenic
922712785 1:227845762-227845784 GGAGGCCTGCTGCAGGCATGCGG - Intronic
922756820 1:228101669-228101691 AGGGGCGTGCTGTGGAGATGGGG - Intronic
923680058 1:236111817-236111839 AGGGGCCAGCAGCCGAGATGTGG - Intergenic
923876840 1:238058687-238058709 AGAAGTCTGCTGCAAGGATGGGG - Intergenic
924256161 1:242184983-242185005 AGAAGCCTGCTACAGGGAGGAGG - Intronic
1063099319 10:2935777-2935799 AGGACCCGGCTGCAGAGATGGGG + Intergenic
1063348433 10:5333383-5333405 GGGGGCCTGTCGGAGGGATGGGG + Intergenic
1063439955 10:6064737-6064759 CAGGGCCTGCTGCAGGGTGGGGG - Intergenic
1063668358 10:8079946-8079968 AGGACCCTGCTGCAGAGATGCGG + Intergenic
1063949829 10:11212191-11212213 AGGGGCCTGCTGCAGGGATGTGG - Intronic
1064079471 10:12296778-12296800 CGGGGCCTGTTGCAGGGTCGGGG + Intergenic
1064398344 10:14999530-14999552 AAGGACCTGCTTCAAGGATGTGG - Intergenic
1064495080 10:15901090-15901112 TGGGGCCTGCTGCAGTGTGGAGG + Intergenic
1066156755 10:32686550-32686572 TGGGGCCTGCTCCAGGGTAGAGG + Intronic
1066212637 10:33254919-33254941 AGGGGCCTTCAGCAGGGACGTGG + Intronic
1066556253 10:36617450-36617472 ATGAGCCTGCTGCTGGGATCAGG + Intergenic
1067175009 10:43939492-43939514 AGGGGCCTGGGGCCTGGATGGGG + Intergenic
1067202979 10:44190334-44190356 TGGGGCCTGTCGCAGGGTTGGGG + Intergenic
1068504074 10:57876979-57877001 CTGGGCCTGCTGCACTGATGTGG + Intergenic
1069686304 10:70321335-70321357 AAGGGCCTGCTGGAGGAAGGAGG - Intronic
1069739518 10:70678644-70678666 AGGGGTGTGGGGCAGGGATGGGG + Intronic
1070003447 10:72399300-72399322 TGGGGCCTGTTGCAGGGTCGGGG + Intronic
1070657459 10:78281267-78281289 TGGGGGCTGCTGAAGGGCTGTGG + Intergenic
1070790677 10:79187519-79187541 AGGGGCCTGGTGCAGCGAGTGGG + Intronic
1070942131 10:80357109-80357131 TCGGGCCTGCGGCAGAGATGAGG + Intronic
1071184295 10:83023078-83023100 AGGGGCCTGTTGGAGGGTGGGGG + Intergenic
1071486580 10:86106477-86106499 AGGGGCCTGCTTCAGGTGTGGGG + Intronic
1071486589 10:86106508-86106530 ATGGGCCTGCTTCAGGTGTGGGG + Intronic
1071486598 10:86106539-86106561 ATGGGCCTGCTTCAGGTGTGGGG + Intronic
1073301108 10:102471382-102471404 ATGGACCTGGTGCAGGTATGGGG + Exonic
1073391026 10:103176360-103176382 AGTTGCCTTCTGCAGGGGTGGGG - Intronic
1073585221 10:104703587-104703609 CGGGGCCTGCTGGAGGGTGGGGG + Intronic
1073841542 10:107504009-107504031 AGGAGTTTGCTGCAGGGGTGGGG - Intergenic
1073969138 10:109026820-109026842 AGGGGCGTAGTGCAGGGATGAGG - Intergenic
1075510954 10:123072819-123072841 CGGGGCCTCCTCCAGGGCTGTGG - Intergenic
1075559853 10:123460546-123460568 AGGAGCCTGCTGGGAGGATGGGG - Intergenic
1075702654 10:124479197-124479219 AGGGGCCTTCTGCAGGGTCCTGG - Intronic
1075826136 10:125358399-125358421 AGAAGCTTGCTGCAGGGGTGGGG - Intergenic
1075842580 10:125517611-125517633 AGGGGCCCAGAGCAGGGATGTGG + Intergenic
1075852878 10:125603302-125603324 AGGTTTCTGGTGCAGGGATGGGG - Intronic
1076166170 10:128284548-128284570 AGGGGCCTGCTGATAGCATGTGG + Intergenic
1076698364 10:132257732-132257754 AGGGGCCTGGTGGAGGGTGGGGG - Intronic
1076982731 11:213437-213459 AGGGGCCTGCAGCTGGGAGAAGG + Intronic
1077052426 11:573311-573333 AGGTGCCTGGTGCAGGGCAGAGG + Intergenic
1077341305 11:2027597-2027619 AGGTGCCTGCTGCAGAGCTGTGG - Intergenic
1078079432 11:8193176-8193198 AGGGTCCTGCGGCAAGGATTGGG + Intergenic
1078180934 11:9009546-9009568 TGGGGCCTGTTGCAGGGTAGGGG - Intergenic
1079500976 11:21100992-21101014 TGGGGCCTGCTGTGGGGTTGGGG - Intronic
1080640392 11:34155124-34155146 AGAGCCCTGCTGCAGGCATCAGG - Intronic
1081625594 11:44653412-44653434 AGGAGGCAGCTGCAGGGCTGGGG + Intergenic
1081770711 11:45649203-45649225 AGGGGCAGGAGGCAGGGATGGGG + Exonic
1082910208 11:58363958-58363980 AGGGGCCTGTTGTGGGGGTGGGG + Intergenic
1083072958 11:60005801-60005823 TGGGGCCTGCTGGAGGGTGGAGG - Intergenic
1083095713 11:60248928-60248950 AGGGGCCTGCTGGGGGGTCGGGG - Intergenic
1083267318 11:61552709-61552731 AGGGCACTGCTGGTGGGATGAGG - Intronic
1083364335 11:62132423-62132445 ACGGGCCTGCTCCAGGGTTTGGG + Intronic
1083571724 11:63764912-63764934 AGTGCCCTGCTGCAGGCCTGGGG - Exonic
1083602166 11:63955526-63955548 AGGGGCCTGCTGCTGGCTGGGGG - Exonic
1083641537 11:64148313-64148335 TGGGTCCAGCTGCAGGGATGTGG - Intronic
1083642696 11:64153938-64153960 AGGGGGCAGCTGCAGGGGCGTGG - Intronic
1083657094 11:64234865-64234887 GGGGGCCAGCTGCAGGAGTGCGG - Exonic
1083782686 11:64926236-64926258 AAGCGCCTGCTCCAGGGATCTGG - Intronic
1084125385 11:67095727-67095749 GGTGGCCTGCTGCAGGAAGGCGG - Intergenic
1084195747 11:67523032-67523054 GGGGACCTGCAGCCGGGATGGGG + Intronic
1084402114 11:68950612-68950634 ACTGGCCTCCTGCAGGGGTGAGG + Intergenic
1084433812 11:69126450-69126472 GGTGGCCTGGTGCATGGATGCGG + Intergenic
1084483242 11:69434055-69434077 AGTGGCCTCCTGCAGGGGAGGGG + Intergenic
1084554682 11:69868710-69868732 AGGGGGCTGCGGCCGGGCTGGGG - Intergenic
1084840749 11:71844202-71844224 ATGGGCCTCCTGCTGGGAGGTGG - Intergenic
1084926746 11:72519744-72519766 TGGGTCCTGCACCAGGGATGAGG - Intergenic
1086991962 11:93313445-93313467 AGAAGTTTGCTGCAGGGATGGGG - Intergenic
1087131014 11:94669294-94669316 AGAGGCCTGCTTAAGGGAGGAGG - Intergenic
1087627317 11:100609985-100610007 TGGGGCCTGTTGGAGGGAAGGGG + Intergenic
1087789563 11:102392080-102392102 AGAGGCCTGTGGCAGGAATGTGG + Intergenic
1087991156 11:104746294-104746316 AGTGGCCTGTTGCAGGGTGGGGG + Intergenic
1088101886 11:106165251-106165273 AGAGGTGTGCTGCAGGGGTGGGG - Intergenic
1088945627 11:114509758-114509780 AGGGGCCTGTTGGAGGGTGGAGG + Intergenic
1089420428 11:118329095-118329117 AGGGGCCTACTTCAGGGTGGAGG + Intergenic
1089459599 11:118644826-118644848 AGAGGCCAGCTGGAGGGGTGAGG - Intronic
1089528784 11:119113389-119113411 TGGGGCCTGCTGAAGGTGTGGGG - Intronic
1089819603 11:121212831-121212853 AGGGGTCTGCATCAGGAATGTGG - Intergenic
1090234190 11:125134328-125134350 ATGGGCCTGAAGCAGGGCTGCGG + Intergenic
1090554821 11:127862929-127862951 TGGGGCCTGCTGGGGGGTTGGGG - Intergenic
1090658690 11:128865146-128865168 AGGGGCCTACTGGAGGCAGGGGG - Intronic
1090963516 11:131578455-131578477 AGGGGAGAGCTGCAGGGAAGTGG + Intronic
1091037035 11:132243852-132243874 AGGGCCATGCTGCAGGGCTGGGG - Intronic
1091239775 11:134044604-134044626 AGGGACCTGCTTCAGGCCTGAGG - Intergenic
1202824290 11_KI270721v1_random:82786-82808 AGGTGCCTGCTGCAGAGCTGTGG - Intergenic
1091793991 12:3286959-3286981 AGGGGCTTCCTGTAGGGGTGGGG + Intergenic
1091837769 12:3597746-3597768 AGTGGCCTGCTTCAGGGCTCTGG + Intergenic
1092195580 12:6547972-6547994 AGGGTCCTGCAGCAGGGATGAGG + Intronic
1092321262 12:7477573-7477595 TGGGGCCTGCTGCGGGGTGGGGG + Intronic
1092529964 12:9335961-9335983 AGCCTCCTGCTGCAGGGCTGAGG - Intergenic
1092597786 12:10026515-10026537 TGGGGCCTGTTGAGGGGATGAGG + Intergenic
1093406793 12:18814062-18814084 TGTGGCCTGCTCCAGGGAAGGGG - Intergenic
1093604960 12:21078226-21078248 AGAAGCTTGCTGCAGGGATGGGG - Intronic
1094176286 12:27545221-27545243 TGGGGCCTGTTGGAGGGGTGGGG + Intronic
1094405325 12:30110565-30110587 AGGAGCCTGCAGCAGGGGCGGGG + Intergenic
1094790070 12:33902456-33902478 TGGGGCCTGTTGTAGGGTTGGGG + Intergenic
1095639544 12:44471973-44471995 TGGGGCCTGCTGGAGGGTGGAGG - Intergenic
1096215546 12:49795947-49795969 GGGGTCCTGCGGCCGGGATGGGG + Exonic
1096571297 12:52524751-52524773 AGGGGCCTGCTGGAGGGAAGCGG - Intergenic
1097249618 12:57625396-57625418 GCTGGCCAGCTGCAGGGATGGGG - Exonic
1097454590 12:59781959-59781981 AGTGGCCTTCTCCAGGGAGGAGG + Exonic
1098201293 12:68058671-68058693 CAGGGCCTGCTGGAGGGCTGGGG - Intergenic
1098461448 12:70737038-70737060 AGGGGGCTGCTCCAGCGAAGTGG - Intronic
1098660532 12:73087706-73087728 AGAAGTTTGCTGCAGGGATGGGG - Intergenic
1099206284 12:79731186-79731208 TTGGGGCTGCTGCAGGGAAGGGG + Intergenic
1099379676 12:81938790-81938812 AGAAGCTTGCTGCAGGGGTGGGG - Intergenic
1100587446 12:95993250-95993272 ATGGGCCAGGTGGAGGGATGGGG - Intronic
1101898373 12:108772358-108772380 TGGGGCCTTCAGCAGGAATGAGG + Intergenic
1103339717 12:120215049-120215071 AGTGGACTCCTGCAGGGGTGGGG - Intronic
1103715184 12:122940955-122940977 AGTGGCCTGATGCAGGGAGTGGG - Exonic
1103880760 12:124164170-124164192 AGAAGCTTGCTGCAGGGGTGGGG - Intronic
1103945320 12:124522970-124522992 AGGGGCCTGCCTCCTGGATGGGG + Intronic
1104859911 12:131918483-131918505 TGGGGCCCGCTGCAGGGAGAGGG - Exonic
1105014666 12:132778980-132779002 TGGGGCCTGCTGCTGGGCCGTGG - Intronic
1105214395 13:18275895-18275917 TGGGGTCAGCTGCAGGGATCTGG - Intergenic
1105296265 13:19090065-19090087 AGGGACCCTCTGCAGGGAGGTGG - Intergenic
1105567429 13:21564454-21564476 AGGGGCCTGCTCTATGGATGTGG + Intronic
1105667908 13:22580657-22580679 TGGGGCCTGTTGTGGGGATGGGG + Intergenic
1106106621 13:26738715-26738737 AGAAGTTTGCTGCAGGGATGGGG + Intergenic
1106194779 13:27483804-27483826 AGGCACCTGCTGGAGGGTTGGGG - Intergenic
1106349115 13:28910542-28910564 TGGGGCCTGCTGGGGGGCTGGGG - Intronic
1106614735 13:31316062-31316084 AGAAGTCTGCTGCAGGGCTGGGG + Intronic
1107047175 13:36006003-36006025 TGGGGCCTGCTGGAGGGTCGGGG + Intronic
1107545703 13:41431677-41431699 AGTGACCTGCTTCAAGGATGTGG - Intergenic
1107547046 13:41443228-41443250 AGTGACCTGCTTCAAGGATGTGG + Intergenic
1107713539 13:43174618-43174640 TGGGGCCTGTTGCAGGGTGGGGG - Intergenic
1109475420 13:62875000-62875022 AGGGGCTTGCTGAAGGAATCTGG - Intergenic
1110062676 13:71062404-71062426 AGAAGTCTGCTGCAGGGGTGAGG - Intergenic
1110394966 13:75019167-75019189 AGGGGCCTGTTGCGGGGTAGGGG + Intergenic
1110406728 13:75159303-75159325 TGGGGCCTGCTTGAGGGAGGAGG + Intergenic
1110418610 13:75279349-75279371 AGGTAGCTGCTGCAGGGATTGGG + Intergenic
1111527601 13:89492413-89492435 AGAAGTTTGCTGCAGGGATGGGG - Intergenic
1111789757 13:92839456-92839478 TGGGGCCTGTTGCAGGGTGGAGG - Intronic
1111819318 13:93194128-93194150 AGAAGTTTGCTGCAGGGATGGGG + Intergenic
1113319431 13:109219722-109219744 AGGGGCTTGCTGGAGGCAAGGGG - Intergenic
1113574029 13:111382023-111382045 GGGGGCCTGTTCCAGGGCTGTGG + Intergenic
1113574131 13:111382408-111382430 TGGGGCCTGTTCCAGGGCTGTGG + Intergenic
1113574178 13:111382565-111382587 TGGGGCCTGTTCCAGGGCTGTGG + Intergenic
1113718630 13:112534140-112534162 CGGGGGCTGCTGCAGGGAATCGG + Intronic
1114664036 14:24368195-24368217 AGGGGGCTTCTGGAGGGAGGCGG + Intronic
1115010610 14:28540435-28540457 AGAGGTGTGCTGCAGGGGTGGGG + Intergenic
1115045241 14:28983946-28983968 TGGGGCCTGCTGGAGGGTGGAGG + Intergenic
1115299288 14:31865815-31865837 ATTGGCCTGCTGCTGGGAGGTGG - Intergenic
1115840278 14:37462086-37462108 AGAAGTCTGCTGTAGGGATGGGG - Intronic
1116192047 14:41674805-41674827 AGGGGGCGGCTGCCGGGAGGAGG + Intronic
1116203256 14:41825875-41825897 AGCAGCCTGCTGCAGGGATTTGG + Intronic
1116378397 14:44232451-44232473 AGAGGTCTGCTGCAGTGTTGGGG - Intergenic
1116485521 14:45444098-45444120 AGAAGTCTGCGGCAGGGATGGGG + Intergenic
1117430503 14:55654865-55654887 CGGGGGGTGCTGCCGGGATGTGG - Intronic
1117518916 14:56530873-56530895 AAAGGCCTGCTCCATGGATGGGG + Intronic
1117851060 14:59970117-59970139 TGGGGCCTACTGGAGGGAGGGGG - Intronic
1119131224 14:72174718-72174740 AGGGACTTGGTGCAGGGATATGG + Intronic
1119258450 14:73220602-73220624 AGGGGCCTCCAGCAGCGAAGGGG + Exonic
1119286232 14:73457816-73457838 AGGGGGCTCCTGGAGAGATGAGG - Intronic
1119441355 14:74630906-74630928 AGGGGCCAGGTGTAGGGAGGAGG + Intergenic
1120246271 14:82010945-82010967 AGGGGCCAGCAGCAGGAATGTGG - Intergenic
1120483132 14:85077505-85077527 TGGGGCCTGTTGGGGGGATGGGG - Intergenic
1120950852 14:90040471-90040493 AGGGGACTGCTACACAGATGTGG + Intronic
1121299436 14:92858802-92858824 TGGGGCCTGTTGCAGGGTGGGGG + Intergenic
1121499066 14:94419217-94419239 AGAGGTGTGCTGCAGGGGTGGGG + Intergenic
1122632167 14:103112022-103112044 AGGGTCCTGGGGCAGGGCTGTGG + Intergenic
1122929002 14:104924845-104924867 AGGAGCCAGCTGCAGAGAGGAGG + Exonic
1123419200 15:20117733-20117755 TGGGGCCTGTTGCAGGGGTGGGG + Intergenic
1123446663 15:20335766-20335788 TGGGACCTGTTGCAGGGGTGGGG - Intergenic
1123528422 15:21124276-21124298 TGGGGCCTGTTGCAGGGGTGGGG + Intergenic
1124103814 15:26718987-26719009 AGGGGCCTGGTGAAGGGCAGTGG - Intronic
1124394242 15:29287111-29287133 AGGGGCATGCAGGAGTGATGAGG - Intronic
1124404065 15:29378567-29378589 ACGGACCTGCTACAGGGAGGAGG + Intronic
1125295983 15:38203677-38203699 AGGAGCAGGCTGCAGGGGTGTGG - Intergenic
1125721332 15:41846536-41846558 AGGGCCCACCTGCAGGGCTGTGG + Intronic
1125767530 15:42145521-42145543 AGGGCCCTGTTGCTGGAATGTGG + Intronic
1126126408 15:45298217-45298239 AGAAGTCTGCTGCAGGGGTGGGG + Intergenic
1127088919 15:55447695-55447717 AGGAGCCTGAGGCAGGGAGGTGG + Intronic
1127598526 15:60511845-60511867 AGAGGCCTGGTGCAGGTAGGAGG + Intronic
1127634921 15:60859902-60859924 AGGGATCGGCTGCAGGGCTGAGG - Intronic
1128747273 15:70123393-70123415 AGGGACTTGCCTCAGGGATGTGG + Intergenic
1128893337 15:71350699-71350721 AGGAGGATGGTGCAGGGATGAGG + Intronic
1129199706 15:73991704-73991726 AGGCACCTGCTGCAGGGAAATGG - Intronic
1129217155 15:74107042-74107064 AGGTGCCTGCTGGAGGGACTGGG + Intronic
1129237095 15:74230164-74230186 AGGGGTCCCCTGCAGTGATGGGG + Intergenic
1129470692 15:75751815-75751837 AGGTGCCTGCTGGAGGGACTGGG - Intergenic
1129519538 15:76177107-76177129 TGAGGGCTGCTGCAGGGCTGGGG - Intronic
1129911945 15:79235036-79235058 AGGGGCCTGCCGAAGTCATGTGG + Intergenic
1130409310 15:83631448-83631470 AGAAGTATGCTGCAGGGATGGGG - Intergenic
1130483905 15:84387077-84387099 AGCGGCTTGCTGAAGGGGTGGGG - Intergenic
1131061108 15:89405183-89405205 AGGGGGTTGCTGCAGTGAGGAGG + Intergenic
1131067377 15:89442915-89442937 AGGGGCCAGCAGCCGAGATGGGG + Intergenic
1131966580 15:97850476-97850498 TGGGGCCTGTAGCGGGGATGCGG - Intergenic
1131974766 15:97933543-97933565 AGAGGTGTGCTGCAGGGAAGGGG - Intergenic
1132517854 16:374192-374214 TGGCCCCTCCTGCAGGGATGTGG - Intronic
1132577717 16:671597-671619 AGGGTCCGGCTGCACCGATGGGG + Intronic
1132703737 16:1232312-1232334 CTGGGGCTGCTGCAGGGCTGGGG + Intergenic
1132704773 16:1239049-1239071 CTGGGGCTGCTGCAGGGCTGGGG - Intergenic
1132707781 16:1254083-1254105 CTGGGGCTGCTGCAGGGCTGGGG - Intergenic
1132994125 16:2814146-2814168 AGGAGCCTCCTTCAGGGAGGTGG + Intergenic
1132996842 16:2827910-2827932 AGGAGCCTTCTTCAGGGAGGTGG - Intergenic
1133038170 16:3046227-3046249 AGGGGCGGGATACAGGGATGGGG + Intergenic
1133214949 16:4286414-4286436 AGGTGGCTGCTGCAGAGGTGAGG + Intergenic
1133229437 16:4359665-4359687 AGGGGCCTGGGGCAGGGAGAAGG + Intronic
1133265316 16:4579933-4579955 AGGGGCCTGAGGGAGGGTTGAGG - Intronic
1134476095 16:14575106-14575128 AGAAGTCTGCTGCAGGGGTGGGG + Intronic
1134641090 16:15829773-15829795 CGGGGCCTGCAGCAGAAATGAGG + Intronic
1134675462 16:16086990-16087012 AGGTGCCTGCTGGCGGGGTGGGG + Exonic
1135115195 16:19718039-19718061 AGGGGTCGGATTCAGGGATGTGG + Exonic
1135836381 16:25829574-25829596 CGGGGCCTGTTGCAGGGTCGGGG - Intronic
1136016227 16:27402823-27402845 GGGGCCCAGCAGCAGGGATGTGG + Intronic
1136551956 16:30986645-30986667 AGGGCCTTGCTGCAAGGATAGGG - Exonic
1136566248 16:31072555-31072577 AGGACCCTGGGGCAGGGATGAGG + Intronic
1136591345 16:31219536-31219558 AGGGGGCTGAGGCAGGGAGGGGG - Intronic
1136641558 16:31569444-31569466 AGGAGCCTGCTGGAGGGTGGTGG + Intergenic
1136662908 16:31780796-31780818 AGAAGTTTGCTGCAGGGATGTGG + Intronic
1138515764 16:57534969-57534991 AGGGGCCAGCTGAAGGGATGGGG + Intronic
1138927012 16:61604571-61604593 CAGGGCCTGTTGCAGGGTTGGGG + Intergenic
1139446388 16:67001062-67001084 CGGGGCCTGGGGCGGGGATGGGG + Intronic
1141064000 16:80899455-80899477 AGGGGCCTGTTGGAGGGTGGGGG - Intergenic
1141120870 16:81355123-81355145 AGGTGCCTGCAGCAGGCAGGGGG + Intronic
1141150479 16:81561467-81561489 AGGGCCCTGCAGCAGGAGTGAGG + Intronic
1142131039 16:88431587-88431609 TGGGGGCTGCTGTAGGGCTGAGG - Exonic
1142254690 16:89008032-89008054 AGGGTCCTCCTGCAAAGATGAGG - Intergenic
1142254782 16:89008444-89008466 AGGGTCCTCCTGCAAAGATGAGG - Intergenic
1142254865 16:89008817-89008839 AGGGTCCTCCTGCAAAGATGAGG - Intergenic
1142254872 16:89008850-89008872 AGGGTCCTCCTGCAAAGATGAGG - Intergenic
1142254917 16:89009054-89009076 AGGGTCCTCCTGCAAAGATGAGG - Intergenic
1142254932 16:89009121-89009143 AGGGTCCTCCTGCAAAGATGAGG - Intergenic
1142254945 16:89009188-89009210 AGGGTCCTCCTGCAAAGATGAGG - Intergenic
1142254960 16:89009255-89009277 AGGGTCCTCCTGCAAAGATGAGG - Intergenic
1203137896 16_KI270728v1_random:1740979-1741001 TGGGGCCTGTTGCAGGGGTGGGG - Intergenic
1142563794 17:826667-826689 AGGGACCTGGTGAAGGGCTGAGG - Intronic
1142563800 17:826687-826709 AGGGACCTGGTGAAGGGCTGAGG - Intronic
1142612497 17:1116877-1116899 AGGGGCCGGCTGCTGGGGGGCGG + Intronic
1143130216 17:4672926-4672948 TGGGGCCTGCTGAAGGCATGGGG + Exonic
1143479843 17:7221865-7221887 AACTGCCTGCTGGAGGGATGGGG + Intronic
1143538106 17:7553696-7553718 AGGTGGCTGGTGCAGGGGTGAGG + Intronic
1144650608 17:17004675-17004697 AGGGGCGTGGTGGAGGGGTGCGG - Intergenic
1144734767 17:17548951-17548973 AGGGTCCTGCTGAGGAGATGTGG - Intronic
1145108831 17:20143800-20143822 GGAGGCCTGCAGCAGGGATGGGG + Intronic
1146059333 17:29596303-29596325 AGGTGCCTGGTGAAGGGAAGGGG + Intronic
1146184662 17:30717087-30717109 CAGGGCCTGTGGCAGGGATGGGG + Intergenic
1146930748 17:36776183-36776205 CGGGGCCTGCTGGAGGGTGGAGG + Intergenic
1147512868 17:41086891-41086913 AGGGGCCTGTTGTGGGGGTGGGG + Intronic
1147597034 17:41724146-41724168 TAGGGCCTCCTGCAGGGTTGTGG - Exonic
1147923459 17:43932708-43932730 AGGGGCCTGCTCAAGTGAGGTGG + Intergenic
1148282749 17:46361650-46361672 AGTCTCCGGCTGCAGGGATGGGG - Intronic
1148304967 17:46579575-46579597 AGTCTCCGGCTGCAGGGATGGGG - Intronic
1148910949 17:50942456-50942478 AGGGGCTGGCGGCAGGTATGTGG - Intergenic
1149577582 17:57725136-57725158 TGGGCCCTGCTGCTGGGAAGGGG - Intergenic
1150281820 17:63933336-63933358 AGGGCTCAGCTGCAGGGCTGAGG - Intergenic
1150876337 17:68975006-68975028 TGGGGCCTGTTGGGGGGATGGGG - Exonic
1151198551 17:72450426-72450448 TGGGGCCTGTTGCGGGGGTGGGG - Intergenic
1151366054 17:73617194-73617216 AGGGGCCTCCTGCAGAGAGGAGG + Intronic
1151429446 17:74052565-74052587 AGGTGGCCCCTGCAGGGATGTGG - Intergenic
1151558099 17:74857006-74857028 CAGCGCCTGCTGCAGGGAAGGGG - Intronic
1151817283 17:76477533-76477555 AGAGGCCCACTGCTGGGATGTGG - Intronic
1151935705 17:77259605-77259627 AGGGGCCTTCTGCAGCCAGGTGG + Intergenic
1152002191 17:77653941-77653963 AGGGGCAGGCAGCAGGGAGGAGG - Intergenic
1152021226 17:77781298-77781320 GGGGGCCTGCTGGAGTGGTGGGG - Intergenic
1152250343 17:79209237-79209259 ACTGGCCTGCTCCTGGGATGGGG - Intronic
1152301106 17:79495624-79495646 AGGGTACTGGGGCAGGGATGGGG + Intronic
1152386403 17:79977408-79977430 AGGGGCCAGGTGGAGGGATGAGG - Intronic
1152499660 17:80699422-80699444 AGTGCCCTGGTGCAGTGATGGGG + Intronic
1153260021 18:3215002-3215024 CGAGGCCTGCTGCTGGGAGGAGG + Exonic
1154506569 18:15046077-15046099 AGAAGTTTGCTGCAGGGATGGGG - Intergenic
1155258022 18:24015060-24015082 AGGTGCGCGCTGCAGGGTTGGGG - Intronic
1155395811 18:25385775-25385797 TGGGGCCTGTTGCGGGGTTGGGG + Intergenic
1155499587 18:26473397-26473419 TGGGGCCTGTAGCAGGGATAGGG + Intronic
1155518206 18:26643670-26643692 AGGGGCCTGCTGGCCGGGTGCGG + Intronic
1156490564 18:37493532-37493554 AAGTGGCTGCTGCAGGGATGCGG + Intronic
1156774105 18:40766190-40766212 CGGGGCCTGTTGCGGGGTTGGGG - Intergenic
1157084341 18:44563632-44563654 CGGGGCCTGCTTGAGGGAGGAGG + Intergenic
1157223124 18:45841161-45841183 GGGGGCCCGCTGCTGGGCTGAGG + Intronic
1157421554 18:47551544-47551566 GGGGGCCTGCTGGAGGGATGTGG + Intergenic
1157527768 18:48398096-48398118 AAGGGCCGGCTGCCGGGATTAGG + Intronic
1158488788 18:57891576-57891598 AGGTGGCTGCTCCAGGGTTGTGG + Intergenic
1158799012 18:60884016-60884038 AAGAGCCTGCTGCATAGATGAGG + Intergenic
1159157316 18:64601348-64601370 AGAGGTGTGCTGCAGGGGTGGGG - Intergenic
1159233031 18:65633874-65633896 TGGGGCCTGTTGCAGGGTGGGGG + Intergenic
1159246393 18:65810706-65810728 TGGGGCCTGTTGGAGGGTTGGGG - Intronic
1159676761 18:71294357-71294379 GGGGACCTGTTGCAGGGTTGGGG - Intergenic
1159717991 18:71849352-71849374 AGAAGTTTGCTGCAGGGATGGGG + Intergenic
1160487229 18:79304669-79304691 AGGTGCCTACAGCAGGAATGAGG - Intronic
1160599419 18:80001309-80001331 AGGAGTTTGCTGCAGGGCTGGGG + Intronic
1160739843 19:680664-680686 CGGGGCCTGCTGGAGGGGCGGGG + Intronic
1160739851 19:680682-680704 CGGGGCCTGCTGGAGGGGCGGGG + Intronic
1161343242 19:3753987-3754009 AGGGACCCGCCCCAGGGATGCGG - Intronic
1161593884 19:5141590-5141612 ACGGGCAGGCTGCAGGCATGGGG + Intronic
1162287163 19:9747435-9747457 TGGGGCCTGCTGGGGGGAGGGGG - Intergenic
1162302114 19:9849997-9850019 AGGGGGCTCCTGCAGGGAGGGGG + Intergenic
1162783772 19:13021578-13021600 AGAGGGCGGCTGTAGGGATGGGG + Intronic
1163023143 19:14494709-14494731 AGGGGGCTGTTTCAAGGATGGGG - Intronic
1163598246 19:18232912-18232934 AGGGGCCTCCTGCAGCGCGGGGG - Intronic
1163713227 19:18859444-18859466 AGTGGCCACCTGCAGGGATGAGG - Intronic
1163720963 19:18898140-18898162 AGGGGCCTAGTGTAGGGGTGGGG + Intergenic
1164586412 19:29478851-29478873 CGGGGCCTGCTGCAGCTCTGGGG - Intergenic
1165166859 19:33863197-33863219 AGGGGCCTGGAGAGGGGATGTGG + Intergenic
1165475111 19:36026074-36026096 AGAGACCTGCTGGAGGGAAGTGG + Intronic
1165913373 19:39243722-39243744 AGGGGACTCCTGTAGGGAGGAGG + Exonic
1165917582 19:39269901-39269923 AGGGGACTCCTGTAGGGAGGAGG - Exonic
1166317675 19:41998152-41998174 AGGGGCCAGCTGCTGGGACCCGG + Intergenic
1166897929 19:46035878-46035900 AGGGGCCTGATGCAGATCTGGGG + Intergenic
1166988773 19:46678245-46678267 GCGGGCCTACTGGAGGGATGTGG - Intronic
1167250197 19:48395262-48395284 GGGGGACTGATGCAGGGAGGGGG - Intronic
1167255015 19:48422103-48422125 AGGAGCCTGCTCCTGGGAGGAGG - Intronic
1167320125 19:48792394-48792416 TGGGGCCTGTTGCAGGGTGGTGG - Intergenic
1167360112 19:49025612-49025634 AGGGGGCTGCCGCCGGGGTGTGG - Intronic
1167441899 19:49513493-49513515 AGGGCCCTGCTGCAGGCGGGCGG + Intronic
1168686358 19:58351716-58351738 AGAGGGCAGCTCCAGGGATGGGG - Intronic
1202648526 1_KI270706v1_random:161097-161119 AGGGTCCTGCTGCACAGCTGTGG + Intergenic
1202688710 1_KI270712v1_random:71059-71081 TGGGGCCTATTGCAGGGGTGGGG + Intergenic
925104949 2:1283210-1283232 ACCAGCCTGGTGCAGGGATGCGG - Intronic
925178915 2:1804004-1804026 ACTGCCCTGCTGCAGGGATAAGG - Intronic
925181522 2:1820060-1820082 AGGGGCCTGGGGGAGGAATGAGG + Intronic
925599036 2:5589308-5589330 AGTGGGCTGAGGCAGGGATGTGG + Intergenic
925702024 2:6648189-6648211 AGGGCCAAGCTGCATGGATGAGG - Intergenic
926050915 2:9744260-9744282 AGGGGTCATCTGCAGGGATCCGG + Intergenic
926120901 2:10240721-10240743 AGGGGGCTGCTGGAGAGAGGGGG + Intergenic
926147443 2:10405257-10405279 AGGGGCCTGCAGTCAGGATGAGG - Intronic
927699100 2:25256736-25256758 AGGGGAGTGTGGCAGGGATGGGG - Intronic
928112475 2:28521926-28521948 TGCAGGCTGCTGCAGGGATGGGG - Intronic
928276711 2:29907770-29907792 ATGGGCCTGAAGCAGGAATGGGG - Intronic
928313529 2:30229982-30230004 CGGGAGATGCTGCAGGGATGGGG - Intergenic
928332692 2:30369814-30369836 AGGGGCTTTCAGCAGGAATGGGG - Intergenic
928438649 2:31273099-31273121 AGAGGCATGCTTCAGGGAAGAGG + Intergenic
929713332 2:44286863-44286885 AGTGAGCTGCTGCAGGGAGGTGG + Intronic
929919169 2:46160426-46160448 AGTGGCCTTCTGCTGGAATGGGG + Intronic
929975104 2:46626096-46626118 AGGGGACTACTGGAGGGAAGAGG - Intergenic
931706658 2:64951840-64951862 GGAGGCCTGCTCCAGGGATGGGG + Intergenic
932121330 2:69103215-69103237 GGAGGGCTGCTGCAGGGCTGGGG - Intronic
932340105 2:70958280-70958302 AGGGGCCTGCTGGAGGGAATGGG - Intronic
932573567 2:72950862-72950884 AGGGGCCTTCTCCGGGGATAAGG + Intronic
932688340 2:73892324-73892346 AGGGACCTGCTTCAGGGTTGAGG - Intronic
932718816 2:74123519-74123541 AGGGGCGTGCAGGAGGGATTCGG + Intergenic
932761236 2:74440419-74440441 AGGGGCCTGCAGAAGGGAGCGGG - Intronic
933132519 2:78690242-78690264 CAGGGCCTGTTGCAGGGTTGGGG + Intergenic
933727467 2:85434975-85434997 AGGGGACAGCTGCGGGGGTGGGG - Exonic
933803704 2:85982858-85982880 AGGAGGCTGCTGCAGCGACGTGG - Intergenic
933957718 2:87385026-87385048 TGGGGCCTACTGCAGGGGTGGGG - Intergenic
934241839 2:90276943-90276965 TGGGGCCTACTGCAGGGGTGGGG - Intergenic
934271333 2:91539745-91539767 TGGGGCCTACTGCAGGGGTGGGG + Intergenic
934299928 2:91770844-91770866 TGGGGTCAGCTGCAGGGATCTGG + Intergenic
934519830 2:95013185-95013207 AGAGGGCTGCTTCTGGGATGTGG - Intergenic
935186317 2:100736716-100736738 CAGGCCCTGGTGCAGGGATGGGG + Intergenic
935376111 2:102399487-102399509 AGGGGCCTGCGGAGGGGAAGCGG + Intergenic
936165325 2:110115540-110115562 AGGGGCCACCTGCAGAGAGGGGG - Intronic
936554951 2:113488034-113488056 GTTGGCCTGCTGCAGGGAGGTGG - Intronic
936839128 2:116748649-116748671 AGGGGCCTGTTGTGGGGTTGGGG - Intergenic
936843515 2:116802612-116802634 AGAAGTTTGCTGCAGGGATGGGG - Intergenic
937074402 2:119090556-119090578 AGGGGCTTCCTGAAGGAATGGGG - Intergenic
938080634 2:128368134-128368156 AGGGGCATGGGGCAGGGGTGTGG + Intergenic
938261877 2:129902603-129902625 AGGGGAATGATGGAGGGATGAGG - Intergenic
938367863 2:130749316-130749338 AGTGGCCTGCTGAGAGGATGAGG - Intergenic
938400385 2:130986515-130986537 TGGGGCCTTCAGCAGGGAAGAGG + Intronic
938792523 2:134689595-134689617 GGAGGCCTGCTTCAGGGATGGGG + Intronic
939681136 2:145134591-145134613 AGGGCCCTGCTGTAGGTAGGAGG + Intergenic
940069662 2:149671668-149671690 TGCGGCCTGTTGCAGGGTTGGGG - Intergenic
940082669 2:149822101-149822123 AGGGGCCTGTTGTAGGGTGGGGG + Intergenic
940083721 2:149834242-149834264 TGGGGCCTGTTGCAGGGTAGGGG - Intergenic
940816890 2:158306666-158306688 CGGGGCCTGTTGCAGGGTGGGGG + Intronic
940871312 2:158862842-158862864 AAGGACCTGCTTCAAGGATGTGG + Intronic
942522228 2:176816571-176816593 CGGGGCCTGTTGGGGGGATGGGG + Intergenic
942818510 2:180081635-180081657 AGGGGTCTGCTGGAGGGTTGAGG - Intergenic
942870862 2:180732683-180732705 AGGGAACTGCTGCAGTGTTGGGG + Intergenic
943507901 2:188785121-188785143 AGGGGCCTGTTGGAGGGTTGGGG + Intronic
943552752 2:189360772-189360794 TGGGGCCTGTTGGAGGGGTGGGG - Intergenic
944372946 2:199007871-199007893 TGGGACCTGTTGCAGGGTTGAGG - Intergenic
945117007 2:206417861-206417883 TGGGGCCTGCTGTGGGGTTGGGG - Intergenic
946155597 2:217804707-217804729 TGAGGCCTGCTGGAGGGATGGGG - Intronic
946890958 2:224276105-224276127 TGGGGCCTGTTGTGGGGATGTGG - Intergenic
947518762 2:230828553-230828575 CGGGGCCCTCTGCAGGGACGCGG - Intergenic
947567903 2:231206911-231206933 ACGGGCCTGGAGCAGGGATGAGG + Intronic
947910487 2:233797737-233797759 AGGGGCCTGCTAGAGGGTTGGGG - Intronic
948846024 2:240683190-240683212 AGGGGCCAGGTGCAGGGAGCAGG - Intergenic
948847832 2:240691539-240691561 AGGGGCCAGGTGCAGGGAGCAGG + Intergenic
948897847 2:240935478-240935500 AGGGGCCTGCAGCAGGCCTGCGG + Intronic
949046570 2:241874994-241875016 AGGGCCCAACTGCAGGGACGAGG + Intergenic
949046606 2:241875099-241875121 GGGGCCCAACTGCAGGGATGAGG + Intergenic
949046622 2:241875151-241875173 GGGGCCCAACTGCAGGGATGAGG + Intergenic
949046638 2:241875203-241875225 GGGGCCCAACTGCAGGGATGAGG + Intergenic
949046820 2:241876316-241876338 AGGGGCCAACTGCAGGGACGAGG + Intergenic
949046941 2:241876687-241876709 AGGGGCCAACTGCAGGGACGAGG + Intergenic
1169204434 20:3732246-3732268 AGGGGTCTGGGGCAGGGAAGTGG + Intergenic
1169779809 20:9296846-9296868 AGGGGCCTGTTGTGGGGTTGGGG + Intronic
1171814601 20:29773686-29773708 AGGGGCCTGTTGCGGGGTGGGGG + Intergenic
1172595613 20:36149233-36149255 AAGGGGCTGGGGCAGGGATGGGG - Intronic
1172760392 20:37317301-37317323 AGGGCCCTGCCCCGGGGATGAGG + Intergenic
1173835996 20:46126131-46126153 AGGGGGATGCTACAGGGATCTGG + Intronic
1173843184 20:46172342-46172364 AGTGGCCAGTGGCAGGGATGTGG - Intergenic
1174258605 20:49277614-49277636 ACGGGCCAGCTGAGGGGATGGGG + Intronic
1175240865 20:57547650-57547672 AGGGGAGTGCTACAGGTATGTGG - Intergenic
1175323656 20:58107565-58107587 AAGGGGCTGCAGAAGGGATGAGG - Intergenic
1175622195 20:60457424-60457446 AGAGGCTTGCTCCAGGGGTGAGG + Intergenic
1175806393 20:61831574-61831596 AGGGACCTGCTGCATGGTTCAGG - Intronic
1175827025 20:61941973-61941995 CTGGGCCTTCTGCAGGCATGTGG + Intergenic
1175853373 20:62105506-62105528 AGGTGCAGGCTGCAGGGAGGTGG - Intergenic
1176083432 20:63285180-63285202 TGGGGCCAGCTGTAGGGGTGAGG - Intronic
1176145937 20:63565498-63565520 CCGGGCCTGCTGCAGGGACTCGG + Exonic
1176167289 20:63680889-63680911 CTGGGCCTCCTGCAGGGATGGGG + Intronic
1176273881 20:64252662-64252684 AAGGGCCTGAGGCAGGGGTGCGG - Intergenic
1176517378 21:7796197-7796219 AGGGTCATGCAGCAAGGATGTGG - Intergenic
1176603328 21:8811590-8811612 AGGGTCCTGCTGCACAGCTGTGG - Intergenic
1176791295 21:13323030-13323052 AGAAGTTTGCTGCAGGGATGGGG + Intergenic
1177176776 21:17708154-17708176 GGGGGCCTGTTGGAGGGTTGGGG - Intergenic
1177267029 21:18798551-18798573 AGAGGTTTGCTGCAGGGATGAGG + Intergenic
1177990497 21:28030341-28030363 AGAAGTTTGCTGCAGGGATGGGG - Intergenic
1178422225 21:32451976-32451998 AGGGGCCTGCTCCAAGGGCGTGG - Intronic
1178457693 21:32771271-32771293 GGGGGCCTGCGTCGGGGATGCGG + Intronic
1178571452 21:33741102-33741124 AGGGGTCTGCAGCACAGATGGGG + Intronic
1178651406 21:34426209-34426231 AGGGTCATGCAGCAAGGATGTGG - Intergenic
1178857891 21:36265567-36265589 AGGGGCCTGCTACAGGCAACAGG - Intronic
1178974514 21:37209475-37209497 AGGCCCCTGCTGCAGGGAGCAGG - Intergenic
1179507956 21:41854438-41854460 CTGGGCCAGCTGCTGGGATGCGG - Intronic
1179533000 21:42032934-42032956 GGGGGCCTTCTGCAGGGCAGAGG - Intergenic
1179577779 21:42318437-42318459 ACGAGGCTGCTGCAGGGATGCGG - Intergenic
1179716315 21:43290545-43290567 CTGGGCTTGCTGCTGGGATGCGG - Intergenic
1179787390 21:43737602-43737624 TGGTCCCTGCTGCAGGGAAGGGG + Intronic
1179888565 21:44324901-44324923 AGGGGCCTGGTGCTGCGGTGAGG + Exonic
1179954344 21:44729831-44729853 AGCGGCCTGCAGCAGGGAGGGGG + Intergenic
1180261290 21:46670851-46670873 AGGAGCCTGGTGAAGGGCTGTGG - Intergenic
1180345613 22:11703147-11703169 AGGGTCCTGCTGCACAGCTGTGG - Intergenic
1180552716 22:16553536-16553558 TGGGGCCTGTTGCAGGGGTGGGG - Intergenic
1181042985 22:20201609-20201631 GGGGGCCTGCTGGGGGGCTGGGG + Intergenic
1181081315 22:20417703-20417725 TGGGGCCTGCTACGGGGATGTGG - Intergenic
1181311994 22:21949899-21949921 GGGGGGCAGCTGCAGGGGTGTGG + Intronic
1181585121 22:23848998-23849020 AGGGGCCTCCTGCGGGGGAGAGG - Intergenic
1181636700 22:24177933-24177955 AGGGGCCTGGGGCAGGGGTGAGG + Intronic
1181698278 22:24604940-24604962 TGGGGTCAGCTGCAGGGATCTGG + Intronic
1181905454 22:26191573-26191595 TGGGGCCTGTTGGAGGGTTGGGG + Intronic
1181975125 22:26723367-26723389 AGGGGCCAGATGGAGGAATGTGG + Intergenic
1182016395 22:27043668-27043690 ATTGCCCTGCTGCCGGGATGAGG + Intergenic
1182034146 22:27184239-27184261 AGGAACCTGCTCCATGGATGAGG + Intergenic
1182097109 22:27633403-27633425 TAGTGCCTGCTGCAGAGATGGGG + Intergenic
1182786842 22:32915110-32915132 TGAGGCCTGCTGCAGGGTGGAGG + Intronic
1182972246 22:34589602-34589624 AGGGGCCGGCAGCTGAGATGTGG + Intergenic
1182992143 22:34778190-34778212 AGAGGTCGGCTGCAGGGGTGGGG + Intergenic
1183012193 22:34955914-34955936 AGAGGCCTGTTGGGGGGATGGGG + Intergenic
1183053052 22:35280538-35280560 AGGAGGCTGCTGCAGGAGTGCGG - Intronic
1183360142 22:37379057-37379079 AAGGGGGTGCTGCAGGGAGGAGG + Intronic
1183978422 22:41526285-41526307 AGGGGCCAGCAGCTGAGATGTGG - Exonic
1184741016 22:46429120-46429142 AGGGGCCGTCTGGAAGGATGGGG - Intronic
1184744044 22:46445906-46445928 AGGGGGCTGCTGGAGGCAGGAGG - Intronic
1184889257 22:47369424-47369446 TGGGGCCTGCTGCAGAGATAAGG - Intergenic
1184904526 22:47471977-47471999 ATAGACCTGCTGCAGGGCTGGGG - Intronic
1185045816 22:48528258-48528280 TGGGGGCTGCTGCAGAGTTGCGG + Intronic
949161196 3:884405-884427 TGGGGCCCGCTGGAGGGTTGGGG - Intergenic
950196382 3:11011971-11011993 GGGGACTAGCTGCAGGGATGGGG - Intronic
950331822 3:12161865-12161887 AGGGGCCTCCTGGGGAGATGTGG + Intronic
950646824 3:14382329-14382351 AGGAGGCTGGTGCAGGGCTGTGG + Intergenic
951252442 3:20409710-20409732 AGTGGCCTGCTGAAGGGATCTGG + Intergenic
951468553 3:23030569-23030591 CGGGGCCTGTTGTAGGGTTGGGG - Intergenic
951794027 3:26517958-26517980 AGAAGTTTGCTGCAGGGATGGGG + Intergenic
952616147 3:35276393-35276415 ATTGTCCTGCTGGAGGGATGGGG - Intergenic
952813925 3:37430742-37430764 AGGGGCCTCCTGCCTGTATGAGG + Intronic
954124711 3:48521551-48521573 AGGCCTCGGCTGCAGGGATGGGG + Intronic
954147678 3:48642328-48642350 TGGGGCCTGGGGCAGGGAGGAGG - Intronic
954364014 3:50136868-50136890 AGGGACATGCAGCCGGGATGTGG + Intergenic
954519456 3:51211513-51211535 CGGGGCCTGCTGTGGGGTTGGGG - Intronic
954622583 3:52004441-52004463 AGGGGCCTGCTGCTGGGGGCTGG + Intergenic
955529535 3:59858648-59858670 AGAGGGGTGCTGCATGGATGGGG + Intronic
956228110 3:66982473-66982495 AGGAGCCTCCTGCAGGGAAGGGG + Intergenic
956998046 3:74850892-74850914 TGGGGCATGATGAAGGGATGTGG - Intergenic
957314427 3:78559325-78559347 AAGGGGCTGCTGCAGAAATGTGG - Intergenic
957861581 3:85958886-85958908 TGGAGCCTGTTGCAGGGTTGGGG + Intronic
958803322 3:98781316-98781338 TGGGGCCTGTCGCAGGGTTGGGG + Intronic
958887165 3:99739461-99739483 AGAAGCCTGCTGCAGGGGCGAGG - Intronic
959462156 3:106640547-106640569 AGGGGCCTGACTCAGGGAAGTGG - Intergenic
959815626 3:110670636-110670658 AGGGCCCCCCTGCAGGGATTTGG + Intergenic
960075602 3:113481570-113481592 CGGGGCCTGTTGGAGGGTTGGGG - Intronic
960081901 3:113550917-113550939 TGGGGCCTGCTGGAGGGTGGAGG - Intronic
960276024 3:115730156-115730178 TGGGGCCTTTTGCAGGGATCAGG - Intergenic
961075327 3:123976838-123976860 AGGGCCCTGCTGCAGCATTGAGG - Intronic
961272236 3:125697899-125697921 AGAGGCCTGCGGCAAGGATCTGG - Intergenic
961308360 3:125975684-125975706 AGGGCCCTGCTGCAGCATTGAGG + Intronic
961365234 3:126395264-126395286 AGGGGGCTGCAGCAGGAATGCGG + Intronic
961655238 3:128438276-128438298 TGGGGCCTGCTGCAGGCCTCTGG + Intergenic
961664174 3:128486102-128486124 AGTGGGCTGCTGTAGGGGTGAGG + Exonic
962438273 3:135386508-135386530 TGGGGCCTGCTGTGGGGTTGGGG + Intergenic
963044564 3:141093132-141093154 ATGGGGCAGCTGCAGGGATGTGG + Intronic
963363211 3:144303186-144303208 AGGAGTTTGCTGCAGGGGTGGGG - Intergenic
964368614 3:155975420-155975442 TGGGGCCTGTTGGAGGGATAAGG - Intergenic
964505661 3:157396087-157396109 TGGGGCCTGCAGCGGGGATGGGG - Intronic
964677896 3:159304015-159304037 TGGGGCCTGCTGTGGGGTTGGGG - Intronic
964982471 3:162703002-162703024 AGGAGCCCACTGCAGGGGTGTGG + Intergenic
965089987 3:164149672-164149694 AGAAGTCTGCTGCAGGGGTGGGG - Intergenic
965365878 3:167799195-167799217 CGGGGCCTGTTGGAGGGTTGGGG - Intronic
965386227 3:168049707-168049729 AAGGGATTGCTGCAGGGATGGGG - Intronic
967412493 3:189180881-189180903 AGAAGTCTGCTGCAGGGGTGAGG - Intronic
967893943 3:194382276-194382298 TGGGGCCAGATGCAGGGGTGAGG + Intergenic
968265583 3:197360520-197360542 AGGAGTTTGCTGCAGGGGTGGGG + Intergenic
968388292 4:166003-166025 TGGGGCCTGCTGTGGGGTTGGGG - Intergenic
968684581 4:1948949-1948971 AGGGGCCTTCTGCATGGCTCAGG - Intronic
968885866 4:3331846-3331868 ATGGGCCTGCGGCAGAGCTGGGG + Intronic
969061401 4:4438136-4438158 AAGGGCCTGCTGGAGGGGTGAGG - Intronic
969177028 4:5406501-5406523 AGAAGTCTGCTGCAGGGGTGGGG - Intronic
969194642 4:5551033-5551055 AGAGGTGTGCTGCAGGGGTGGGG + Intronic
969346793 4:6575194-6575216 CCCGGCCTGCCGCAGGGATGGGG + Exonic
969461632 4:7332186-7332208 AAGGGCCTGCTGCCCTGATGTGG + Intronic
969538594 4:7771845-7771867 AGGAGACTGGGGCAGGGATGGGG + Intronic
969574775 4:8030436-8030458 AGTGTCCTGCTGCAGGGTGGAGG + Intronic
969781845 4:9410195-9410217 ATGGGCCTCCTGCTGGGAGGTGG - Intergenic
970141637 4:12989323-12989345 AGTGGCCGGCGGCGGGGATGGGG + Intergenic
970629566 4:17925450-17925472 AGGTGCCTGCTGAAGGGAAAGGG + Intronic
970804908 4:20019234-20019256 CGGGGCCTGTTGGAGGGGTGGGG + Intergenic
970945297 4:21683963-21683985 TGGGGCCTGCTTGAGGGAGGAGG + Intronic
971478468 4:27093557-27093579 TGGGGCCTGTTGCAGGGTGGGGG + Intergenic
972887493 4:43510247-43510269 AGAAGTCTGCTGCAGGGGTGGGG - Intergenic
973031619 4:45348965-45348987 CAGGGCCTGTTGCAGGGTTGGGG + Intergenic
973237107 4:47917196-47917218 AAGGGCCTGTTGCAGGGTGGGGG - Intronic
974145125 4:57937288-57937310 AGGAGCTTGCTGCAGGGGTGAGG + Intergenic
974215554 4:58842051-58842073 AGAAGTTTGCTGCAGGGATGGGG + Intergenic
974763408 4:66308130-66308152 AGAAGTTTGCTGCAGGGATGGGG + Intergenic
975238841 4:72032433-72032455 AGGGACCTGGTCAAGGGATGTGG + Intronic
975306631 4:72856751-72856773 TGGGGCCTGCTGCGGGGTGGGGG + Intergenic
975649914 4:76582764-76582786 AGAGGCCTCCTCCAAGGATGAGG + Intronic
977219245 4:94319914-94319936 TGGGGCCTGTTGCAGGGTGGGGG - Intronic
977381663 4:96282122-96282144 GGAGGACTGCTGCAGGAATGTGG - Intergenic
978076694 4:104539995-104540017 CGGGGCCTGTTGGAGGGTTGGGG - Intergenic
978459418 4:108934322-108934344 CGGGGCCTGTTGGGGGGATGGGG + Intronic
980318931 4:131242312-131242334 TGGGGCCTGTTGCGGGGGTGGGG - Intergenic
980699092 4:136400431-136400453 AGGTGCCTGTAGCAGAGATGTGG - Intergenic
981308091 4:143267884-143267906 AGAAGTTTGCTGCAGGGATGGGG + Intergenic
982226231 4:153170010-153170032 TGGCGCCTGCAGCTGGGATGTGG + Intronic
982299895 4:153867831-153867853 AGAAACTTGCTGCAGGGATGGGG + Intergenic
982459905 4:155656225-155656247 AGCTGCCTGCAGCAGGCATGAGG - Intergenic
982582866 4:157201486-157201508 CAGGGCCTGTTGCAGGGTTGTGG - Intergenic
982596273 4:157388861-157388883 AGGGTCTTGCTTCAGGAATGTGG - Intergenic
983157510 4:164369094-164369116 AGTGGGCTGCTCCGGGGATGAGG + Intronic
984306242 4:177995696-177995718 AGGGGCCTGCAGTAGGGACAAGG + Intergenic
984416006 4:179459206-179459228 AGAAGTTTGCTGCAGGGATGGGG + Intergenic
984431901 4:179661016-179661038 AGAGAACTGCTGCAGGGGTGAGG + Intergenic
985553072 5:543055-543077 AGGAGCCTGCTGCAGGCGGGTGG + Intergenic
985562729 5:599339-599361 TGGGGCCTCCTGGAGGGTTGGGG - Intergenic
985710168 5:1423393-1423415 AGGGTCCCTCTCCAGGGATGAGG + Intronic
985816605 5:2132400-2132422 AGGAGCCTGCAGCCGGGATGGGG - Intergenic
985939656 5:3125124-3125146 AGGTGCCTGCAGGAGGGATATGG - Intergenic
986130684 5:4927108-4927130 GGAGGCCTGCTGAAGGCATGAGG - Intergenic
986210523 5:5667407-5667429 AGGGGCCTGCTGCCTGGCTATGG + Intergenic
986284002 5:6346744-6346766 AGGGGCTTCCTGTAGGGATTTGG - Intergenic
986777509 5:11031376-11031398 AGCTGCCTGCTACAGGGCTGAGG + Intronic
987147726 5:15008782-15008804 AGTGGCCTGCTGCAGTGATGTGG + Intergenic
989242424 5:39216561-39216583 TGGGGCCTGTTGCAGGGCAGGGG - Intronic
989298904 5:39864854-39864876 CGGGGCCTGCTTGAGGGTTGAGG - Intergenic
989481491 5:41935759-41935781 AGCAGACTACTGCAGGGATGGGG + Intronic
989719296 5:44505091-44505113 AGAGACTTGCTGCAGGGGTGGGG + Intergenic
989745133 5:44820139-44820161 AGGATGCTGGTGCAGGGATGAGG + Intronic
990794528 5:59524967-59524989 AAGAGCCTGCTGCAGGGACGGGG + Intronic
990854538 5:60249105-60249127 GGGGTCCAGCTGCAGGGATATGG - Intronic
990989877 5:61674486-61674508 AGGGGCCTGCAGCAGGTCTCAGG - Intronic
991250122 5:64550733-64550755 TGGGGACTGTTGCAGGGTTGGGG - Intronic
991923116 5:71677345-71677367 AGAGGTGGGCTGCAGGGATGTGG + Intergenic
992350263 5:75921198-75921220 AGGGGCCAGCAGCCGAGATGTGG + Intergenic
992502878 5:77359121-77359143 AGGGGCTTGCAGCCGGGAGGAGG + Intronic
993867349 5:93211241-93211263 AGAGGCTAGCTGCTGGGATGTGG - Intergenic
994262753 5:97679418-97679440 TGGGGCCTGTTGCGGGGTTGGGG - Intergenic
994719305 5:103362797-103362819 CGGGGCCTGTTGCGGGGGTGGGG - Intergenic
995113525 5:108454023-108454045 AGAAGTTTGCTGCAGGGATGGGG + Intergenic
995141580 5:108741223-108741245 AGAGAGCTGCTGCAGGGATAGGG - Intergenic
996911396 5:128660737-128660759 AGGAGTTTGCTGCAGGGGTGAGG + Intronic
996954251 5:129164306-129164328 AGGGGGTTGCTGCAGGCCTGGGG + Intergenic
997978229 5:138452914-138452936 GGGGGCCTGTTGCAGGGATAGGG - Intergenic
998174476 5:139893522-139893544 AAGGAGCTGCTGCAGGGATCAGG - Intronic
998179370 5:139925772-139925794 AGAGGACCCCTGCAGGGATGGGG + Intronic
999110925 5:149121008-149121030 AGAGGTCTCCTGCAGGGATAAGG - Intergenic
999243689 5:150141957-150141979 AGGGCCATGCTGCAGGGAGAGGG + Intronic
999246101 5:150155590-150155612 AGGGGGCTGCTGTAGGGGAGAGG + Exonic
999616869 5:153434157-153434179 AGGGGACTGCTGGAGGGCTGAGG - Intergenic
1000492041 5:161926053-161926075 AGAAGTTTGCTGCAGGGATGGGG + Intergenic
1000749912 5:165082071-165082093 AGGGGCCTGTTGTGGGGTTGGGG - Intergenic
1001014299 5:168126654-168126676 CGGGGCCTGCTCCAGGGGTCTGG + Intronic
1001242498 5:170081187-170081209 AGGTGCCTGTTCCAGGGAAGAGG - Intronic
1001967265 5:175919947-175919969 TGGGGCATGCTTCAGGGCTGGGG - Intronic
1002066480 5:176654526-176654548 GGAGGCCTGCTGCAGACATGGGG + Intronic
1002201045 5:177528508-177528530 AGGAGCCTGCTGCTGGGCTGAGG + Intronic
1002320277 5:178371410-178371432 AGGGGCCGGCTGCAGCTCTGGGG + Intronic
1002518788 5:179778739-179778761 AGTGGCAGGCTGCAGGGATCTGG - Intronic
1002681757 5:180970389-180970411 TGGGGCCGCCTTCAGGGATGCGG - Intergenic
1002789690 6:427987-428009 AGATGCCTGGTGCAGGGAGGGGG - Intergenic
1002934705 6:1661767-1661789 TGGGTCCAGCTGCAGTGATGGGG + Intronic
1002991714 6:2245182-2245204 AGGGGTCTGCTGCCGGGAGGTGG - Intronic
1003088857 6:3084164-3084186 AGGAGCCTGCTGCAGAAACGAGG - Intronic
1003121427 6:3321890-3321912 AGGGGCCTGCTGGGGAGAGGGGG + Intronic
1003512020 6:6789743-6789765 AGGAGCCAGCTGCAGGGAGGTGG - Intergenic
1003730198 6:8813083-8813105 AGGGGCCTGTTGTGGGGTTGGGG + Intergenic
1004162148 6:13223946-13223968 AGTGGTGTGCTGCAGGGATGTGG - Intronic
1004819707 6:19353975-19353997 TGGGGCCTGTTGGAGGGTTGGGG + Intergenic
1005268399 6:24137685-24137707 CGGGGACTGCTGCGGGGTTGGGG - Intronic
1005988893 6:30891310-30891332 CCAGGCCTGATGCAGGGATGGGG + Intronic
1006169089 6:32082781-32082803 AGAGGCCTGCAGCATAGATGAGG - Intronic
1006215048 6:32434329-32434351 AGGGGCCTGTTGGGGGGGTGGGG + Intergenic
1006388633 6:33746202-33746224 TGGGGCCTGGTGCAGGGTGGTGG - Intronic
1006509593 6:34514930-34514952 GGGGGCCTGCTGCCGGGCTGGGG - Intronic
1007111620 6:39316212-39316234 GGGGGCCTCATGCAGAGATGGGG + Intronic
1007375065 6:41450973-41450995 AGAGGCTTGCTGCTGGGGTGGGG + Intergenic
1007425199 6:41742079-41742101 TGGGGACAGGTGCAGGGATGGGG + Intronic
1007633065 6:43283433-43283455 CGGGGCCTGGGGCAGGGCTGGGG + Exonic
1008241912 6:49124141-49124163 TGGGGCCTAGTGCAGGAATGCGG + Intergenic
1008242251 6:49127677-49127699 AGAGGTTTGCTGCAGGGATGAGG + Intergenic
1010101876 6:72119806-72119828 AGGGGCCTGTTGTGGGGTTGGGG - Intronic
1011287950 6:85744915-85744937 AGAAGTCTGCTGCAGGGGTGAGG + Intergenic
1011343766 6:86346688-86346710 AGAGGTGTGCTGCAGGGGTGGGG - Intergenic
1011356745 6:86479221-86479243 AGGGGCCTGATCCAGGCTTGGGG - Intergenic
1011520001 6:88194667-88194689 AGGGGACTACTGCGGGGCTGAGG - Intergenic
1012649594 6:101736386-101736408 AGAAGTTTGCTGCAGGGATGGGG - Intronic
1014410036 6:121103572-121103594 TGGGGCCTGTTGTAGGGAGGGGG + Intronic
1014671339 6:124308144-124308166 TGGGGCCTGCTGCGGGGTGGGGG - Intronic
1016356909 6:143228109-143228131 CAGGGACTGGTGCAGGGATGAGG - Intronic
1017000681 6:149995395-149995417 AGGAGCCTGCAGCAGGGGTGAGG + Intergenic
1017007319 6:150037593-150037615 ACGAGGCTGCTGCAGTGATGAGG + Intergenic
1017179040 6:151532963-151532985 AGGGCCCTGCGGCAGGGATCTGG - Intronic
1017775348 6:157676166-157676188 AGGGGGATGCTGCAGGAAGGTGG + Exonic
1017847769 6:158274378-158274400 AGGAGGCTGCTGCAGTGATCCGG - Intronic
1017882592 6:158572222-158572244 AGGCGTGTGCTGCGGGGATGTGG + Intronic
1018211229 6:161484012-161484034 TGGGGCCTGCTGGGGGGTTGTGG + Intronic
1018527921 6:164734713-164734735 CGGGGCCTGCTGAGGGGGTGGGG - Intergenic
1019058718 6:169241017-169241039 AGGAGCCTGGGGCAGGGAGGGGG - Intronic
1019417571 7:934463-934485 TGGGGGCTGCTGTGGGGATGGGG - Intronic
1019455819 7:1126950-1126972 AGGGGCCTGCAGCAGGCCTTCGG - Intronic
1019478873 7:1256969-1256991 TGGGGCCTGGTGCAGGCAGGGGG - Intergenic
1019601668 7:1886780-1886802 AGAGACCTGCTGCAGGGCTGGGG + Intronic
1019732300 7:2634838-2634860 AGGGACCTACAGCAGGGCTGCGG - Intronic
1019758607 7:2791713-2791735 AAGGGTCTACTGCAGGGGTGGGG + Intronic
1019835488 7:3378929-3378951 AGGGGTCTGCTCCGGGGAAGGGG - Intronic
1019884577 7:3892822-3892844 AGTGGCTTGCTGCAGGGATACGG - Intronic
1020305992 7:6835233-6835255 AGTGACCTGCTTCAAGGATGTGG - Intergenic
1020606920 7:10350592-10350614 AGGGGCCTGCTTGAGGGTGGAGG - Intergenic
1020686479 7:11302041-11302063 AAGGTCCTGCTACAGGGATGAGG + Intergenic
1022044238 7:26610641-26610663 AGGAGCCAGCTGGAGGGAGGGGG + Intergenic
1025285788 7:57659689-57659711 AGAAGCTTGCTGCAGGGGTGGGG + Intergenic
1025940281 7:66071841-66071863 AAGGCCATGCTGTAGGGATGGGG - Intergenic
1026141885 7:67713502-67713524 GGGGAGCTGATGCAGGGATGGGG - Intergenic
1026836759 7:73644867-73644889 AGGGGCCTGATGCCCTGATGGGG - Intergenic
1026898781 7:74026009-74026031 ATGTGCCTGCTGCAGGGGAGGGG - Intergenic
1027267764 7:76503641-76503663 AGGGGCAGACTGCTGGGATGTGG - Intronic
1028138362 7:87245855-87245877 AGAAGTTTGCTGCAGGGATGGGG + Intergenic
1028645979 7:93097331-93097353 AGGGAGCTGCCACAGGGATGGGG + Intergenic
1028780967 7:94736105-94736127 TGGGGCCTGCTGGAGGGTGGAGG + Intergenic
1028964062 7:96781935-96781957 AGTGGCTTTCTGCAAGGATGTGG - Intergenic
1029080127 7:97966502-97966524 AGTGACCTGCTTCAAGGATGTGG - Intergenic
1029100183 7:98123101-98123123 GGGAGCCAGCAGCAGGGATGGGG - Intronic
1030348780 7:108460313-108460335 GGAGGCCTGCAGCATGGATGTGG - Intergenic
1030471872 7:109974723-109974745 TGGGGCCTGTTGCAGGGTGGGGG - Intergenic
1031682395 7:124690514-124690536 AGTGGCCTGGGGCAGGGGTGGGG + Intergenic
1032279178 7:130486964-130486986 GGGGGCCTGGTTCAGGGAGGGGG + Intronic
1032471302 7:132181321-132181343 AAGGGGCTGCTGCATGGAAGGGG - Intronic
1033129746 7:138735583-138735605 AGGAGCCGGCTGCTGGGAAGCGG + Intronic
1033477155 7:141702079-141702101 CGGGGCCTGCGGCAGGGAGACGG + Exonic
1034565095 7:151907450-151907472 TGGGGCCTGTTGGAGGGCTGGGG + Intergenic
1034646933 7:152656053-152656075 CGGGGCCTGCTGAAGGCATGAGG + Intronic
1034729308 7:153370231-153370253 AGGGCCCTGCTGAAGGCCTGGGG + Intergenic
1034740107 7:153465884-153465906 AGAAGTTTGCTGCAGGGATGGGG + Intergenic
1034855158 7:154538395-154538417 TGGGGCCTGTTGCAGGGGTCAGG - Intronic
1034907562 7:154964127-154964149 AGGGGGCTGCTGCTGGCATAGGG - Intronic
1035126647 7:156612549-156612571 AGGGGCTTGCTGGAGGGAGCCGG + Intergenic
1035389523 7:158496197-158496219 AGGGGGAGGCTGCAGGGAAGGGG - Intronic
1035389609 7:158496411-158496433 AGGGGGAGGCTGCAGGGAAGGGG - Intronic
1035389679 7:158496584-158496606 AGGGGGATGCTGCAGGGAAGGGG - Intronic
1035389813 7:158496900-158496922 AGGGGGATGCTTCAGGGAAGGGG - Intronic
1035578850 8:727511-727533 AGGGGTCTGCAGCAGGCAGGCGG - Intronic
1035823873 8:2623705-2623727 CGGGGCCAGATGCAGTGATGCGG - Intergenic
1035921095 8:3676991-3677013 CGGGGCCTGTTGCGGGGTTGGGG + Intronic
1036072605 8:5458124-5458146 AGGGGACTGCTGTAGGGTAGGGG - Intergenic
1036967736 8:13319456-13319478 AGGGGCCTGCTGGCGGGGCGGGG + Intronic
1037821966 8:22139382-22139404 TGGGGGCTGCTGGAGGGCTGGGG + Intronic
1038423064 8:27445957-27445979 AGGAGGCTGCTGGAGGGAGGTGG + Intronic
1038752170 8:30305681-30305703 AGGGGACTGTTGCAGACATGGGG - Intergenic
1041318585 8:56590514-56590536 AGGGGCCTGTATCAGGGACGTGG - Intergenic
1041364649 8:57089139-57089161 TGGGGCCTGTTGGAGGGGTGGGG - Intergenic
1041387660 8:57321102-57321124 CAGGGCCTGTTGCAGGGTTGGGG - Intergenic
1041510352 8:58648856-58648878 AGAAGCCTGCTACAAGGATGGGG + Intronic
1041724395 8:61004699-61004721 AGGAGCCGGCAGCAGGGCTGCGG + Intergenic
1041971068 8:63743245-63743267 TGGGACCTGTTGCAGGGTTGGGG + Intergenic
1042119330 8:65467355-65467377 CGGGGCCTGTTGCAGGGTGGGGG + Intergenic
1042693933 8:71534740-71534762 CAGGGCCTGTTGCAGGGCTGGGG + Intronic
1042876965 8:73448945-73448967 AGGGGCCTGCAGCCCGGCTGGGG + Intronic
1043652007 8:82607946-82607968 ACGGGACTGCTGGAGGGAGGAGG - Intergenic
1043805891 8:84671481-84671503 AGAAGTTTGCTGCAGGGATGGGG - Intronic
1045510440 8:102808664-102808686 TGGGGCCCCCTGCAGGGATGTGG - Intergenic
1045560472 8:103257184-103257206 AAGGGCCTGCTGCTGTGTTGAGG - Intergenic
1048064247 8:130951345-130951367 AGGGCACTGATGCATGGATGGGG + Intronic
1048396905 8:134022514-134022536 AGGAGCCAGCTCTAGGGATGGGG + Intergenic
1049622248 8:143603779-143603801 AGAGGCCTGTAGCAGGCATGGGG + Intergenic
1049791232 8:144473589-144473611 TGTGGCCTGATGCAGGGCTGGGG - Exonic
1049803513 8:144528838-144528860 CCGGGCCTGCAGCGGGGATGGGG - Exonic
1049898055 9:129150-129172 GTTGGCCTGCTGCAGGGAGGTGG + Intronic
1050392142 9:5155313-5155335 TGGGGCCTGTTGCAGGGTTGGGG + Intronic
1050559502 9:6820431-6820453 AGGGGCCTGAGACAGGGCTGTGG + Intronic
1053157728 9:35792119-35792141 GGGGGCCTGCGGCCAGGATGGGG - Intergenic
1053237734 9:36470770-36470792 TGGGGGCTGCTGCATGGAAGTGG - Intronic
1053277352 9:36793513-36793535 AGGTGTCTGTGGCAGGGATGGGG + Intergenic
1053741133 9:41139448-41139470 GTTGGCCTGCTGCAGGGAGGTGG + Intronic
1054346343 9:63968937-63968959 GTTGGCCTGCTGCAGGGAGGTGG + Intergenic
1054444119 9:65295587-65295609 GTTGGCCTGCTGCAGGGAGGTGG + Intergenic
1054452364 9:65410040-65410062 AGGGGATGGCTGCAGGGAGGAGG - Intergenic
1054486153 9:65725918-65725940 GTTGGCCTGCTGCAGGGAGGTGG - Intronic
1054687216 9:68291849-68291871 GTTGGCCTGCTGCAGGGAGGTGG - Intronic
1056971159 9:91204951-91204973 TGGGGCCTGTTGCAGGGTGGGGG + Intergenic
1057018725 9:91679082-91679104 AAGTGCCTGCTGCAGGACTGGGG - Intronic
1057263411 9:93598678-93598700 CGGGGCCTGGGGCTGGGATGAGG + Intronic
1057270885 9:93650752-93650774 AGGGGCCAGCTGGAGGGCAGAGG - Intronic
1057299035 9:93865855-93865877 AGGGACATGGTGCAGGCATGGGG + Intergenic
1057879365 9:98781640-98781662 AGGGGCCTGCAGCAGGGAAGGGG + Intronic
1058202487 9:102061706-102061728 CGGGGCCTGTTGCAGGGGTGGGG - Intergenic
1058401560 9:104625346-104625368 AGAAGTTTGCTGCAGGGATGGGG + Intergenic
1058940527 9:109809037-109809059 AGAGGTGTGCTGCAGGGGTGGGG + Intronic
1059160145 9:112026378-112026400 TGGGGCCTGTTGGGGGGATGGGG - Intergenic
1059434971 9:114270634-114270656 AGGGTCCTGCCCCAGGGAGGGGG + Intronic
1059788731 9:117616634-117616656 AGGGGCTTGCTGCAGGAGGGAGG - Intergenic
1060413615 9:123415734-123415756 AGGGCCCTGCTGCAGGGATGCGG + Intronic
1060790726 9:126483765-126483787 TAGAGCCTGCTGCAGGAATGTGG - Intronic
1061072940 9:128322914-128322936 AGCGGCCTGCGGCAGGCAAGTGG + Exonic
1061170241 9:128948131-128948153 GGGAGCCTGCAGCAGGGACGTGG - Intronic
1061678046 9:132229424-132229446 TGAGGGCTGCTGCAGGGCTGAGG - Intronic
1061680414 9:132240266-132240288 GGGGGCCAGCTGCAGGGACAGGG + Intronic
1061715596 9:132516995-132517017 AGCTGCGTGCTGCAGGGCTGGGG - Intronic
1061906436 9:133701743-133701765 AGGGGGCTCCTGCAGGAAGGAGG - Intronic
1061926046 9:133806539-133806561 AGAGGCCTGGGGCGGGGATGGGG - Intronic
1061975070 9:134063951-134063973 GGGGGCCTGCGGCAAGGAGGGGG + Intronic
1061986920 9:134135485-134135507 CGGGGCCGGCTGCCGGGCTGGGG - Intronic
1062030236 9:134358878-134358900 CGGGGCCTGCTGCTGGGCTCAGG + Intronic
1062046420 9:134426604-134426626 AGGGGCCTAGTGCACGGCTGGGG - Intronic
1062090021 9:134671026-134671048 CGGGGCCTGCTGCAGCTTTGGGG + Intronic
1062167353 9:135114583-135114605 TGTGGCCTGGGGCAGGGATGGGG + Intronic
1062207610 9:135345968-135345990 AGGCGCCTGCAGGAGGGCTGTGG + Exonic
1062331429 9:136046496-136046518 AAGTGACTGCTGCAGAGATGAGG + Intronic
1062718318 9:138022322-138022344 AGGGGGCAGCTGCGGGGCTGCGG + Intronic
1185504181 X:619592-619614 AGGAGCCTGGGGCAGGGGTGGGG + Intergenic
1185532899 X:835851-835873 TGGGGCCTGTTGCAGGGGTGGGG - Intergenic
1185621561 X:1453628-1453650 AGGGGCCCGGCGCAGAGATGGGG + Intronic
1185731664 X:2466618-2466640 AGGGGCATGCTGGAGGGTGGAGG + Intronic
1185732437 X:2472314-2472336 AGGGGCCTGCTGGAGGGTGGAGG + Intronic
1185749598 X:2600181-2600203 CGGGGCCTGTTGCAGGGTGGGGG + Intergenic
1186082359 X:5946834-5946856 TGGGGCCTGCTGGAGGGTGGAGG - Intronic
1186195678 X:7108511-7108533 AGGGGTCTTCTGCAGGGAAGAGG - Intronic
1188336412 X:28939519-28939541 AGGGGCCTACTTCAGGGTGGAGG + Intronic
1188482852 X:30652885-30652907 AGGGGCCAGATGCAGGGAGGTGG + Intergenic
1189191380 X:39110668-39110690 TGGGGCCTGCTTGAGGGAGGAGG + Intergenic
1189998849 X:46665152-46665174 AGGGTCCTGCTGTAGGGAGGAGG - Intronic
1190265206 X:48823978-48824000 CTAGGCCTGCTGCAGGTATGGGG - Exonic
1192559172 X:72114344-72114366 AGAGGCCTGCTCCAGAGAGGAGG - Intergenic
1193392737 X:80948624-80948646 AGTGGCCTGCTGCACTGGTGGGG + Intergenic
1194347102 X:92779320-92779342 TGGGGCCTACTGGAGGGTTGAGG + Intergenic
1194552604 X:95320174-95320196 AGCAGTCTGTTGCAGGGATGAGG + Intergenic
1195110932 X:101648454-101648476 CGGGGCCTGTTGTAGGGTTGGGG + Intergenic
1195136069 X:101908549-101908571 AGGCTGCAGCTGCAGGGATGGGG - Intronic
1195201358 X:102553244-102553266 TGGGGCCTGTTGGAGGGGTGGGG - Intergenic
1195329162 X:103782797-103782819 AGGGGCCTGCAGCCGGGGGGTGG - Intronic
1195340741 X:103904206-103904228 AGGGACCTGCTGGAGGGTGGGGG - Intergenic
1195462529 X:105143827-105143849 AGGGGCCTGTTGTAGGGTGGAGG + Intronic
1196168470 X:112561436-112561458 TGGGGCCTGTTGCAGGGGTGGGG + Intergenic
1197051750 X:122067363-122067385 CGGGGCCTGTTGCAGGGTCGGGG + Intergenic
1197092572 X:122556296-122556318 AGAAGTTTGCTGCAGGGATGGGG + Intergenic
1197466219 X:126807220-126807242 AGAAGTTTGCTGCAGGGATGGGG + Intergenic
1197479956 X:126970426-126970448 TGGGGCCTGTTGGTGGGATGGGG + Intergenic
1197581007 X:128283644-128283666 TGGGACCTACTTCAGGGATGGGG - Intergenic
1197715548 X:129703743-129703765 AGGGGCCTGCTGCCATGGTGAGG + Intergenic
1198962796 X:142200714-142200736 AGGGAACTTCTGCAGGGATGAGG + Intergenic
1199192069 X:144981942-144981964 AGAGGTGTGCTGCAGGGGTGGGG + Intergenic
1200142104 X:153907527-153907549 AGGGGCCTGGGCCAGGGCTGAGG + Exonic
1200167213 X:154045086-154045108 AGGGACCTGCCGGAGGTATGAGG + Intronic
1200655428 Y:5895958-5895980 TGGGGCCTACTGGAGGGTTGAGG + Intergenic
1201543429 Y:15133854-15133876 TGGGGCCTGCTGTGGGGTTGGGG - Intergenic
1201626314 Y:16018585-16018607 TGGGGCCTGTTGCTGGGGTGGGG - Intergenic
1202243849 Y:22796067-22796089 AGGGGGCTGCAGGAGGGAGGAGG + Intergenic
1202366332 Y:24168425-24168447 AGTGGCTTGCTGAAGGGGTGGGG - Intergenic
1202374171 Y:24218219-24218241 AGTGGCTTGCTGAAGGGGTGGGG + Intergenic
1202396836 Y:24429817-24429839 AGGGGGCTGCAGGAGGGAGGAGG + Intergenic
1202473947 Y:25240275-25240297 AGGGGGCTGCAGGAGGGAGGAGG - Intergenic
1202496610 Y:25451901-25451923 AGTGGCTTGCTGAAGGGGTGGGG - Intergenic
1202504449 Y:25501698-25501720 AGTGGCTTGCTGAAGGGGTGGGG + Intergenic