ID: 1063949864

View in Genome Browser
Species Human (GRCh38)
Location 10:11212337-11212359
Sequence CTGTGAAGGCAGGCCCGGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 292}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063949864_1063949872 -3 Left 1063949864 10:11212337-11212359 CCCCCCCGGGCCTGCCTTCACAG 0: 1
1: 0
2: 3
3: 26
4: 292
Right 1063949872 10:11212357-11212379 CAGACAATGCTCTGTGCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063949864 Original CRISPR CTGTGAAGGCAGGCCCGGGG GGG (reversed) Intronic
900147679 1:1165540-1165562 CTGAGAAGGCTGGCCCTGGGTGG + Intergenic
900501281 1:3005928-3005950 CTGGGCAGGCAGGGCAGGGGAGG + Intergenic
900515924 1:3082229-3082251 CTGTGCAGTCAGGCCCTGTGTGG + Intronic
900659327 1:3774876-3774898 CTGGGGAGGCTGGCCAGGGGAGG - Intronic
901765454 1:11497008-11497030 CTGAGAAGGCAGGCACGGGGTGG + Intronic
901773811 1:11545388-11545410 CTCTGATGCCAGGCCTGGGGAGG - Intergenic
902176313 1:14653468-14653490 CTGAGAATGTAGGCCCGGGGCGG + Intronic
902232382 1:15036261-15036283 CTGGGTAGGCAGGGCAGGGGAGG - Intronic
902232420 1:15036364-15036386 CTGGGCAGGCAGGGCAGGGGAGG - Intronic
902581545 1:17410746-17410768 CTGTGTGGGAAGGCCCGAGGTGG - Intronic
903189486 1:21648873-21648895 CTGGGAAGCCAGGCCTGGGGTGG - Intronic
904314622 1:29652184-29652206 CTGTGAGCGCAGGGCCAGGGAGG + Intergenic
905214564 1:36397729-36397751 CGGTGCAGGGAGCCCCGGGGCGG - Intronic
905467272 1:38164728-38164750 CTGAGAAGGCATGCCTGGAGAGG - Intergenic
905881770 1:41468605-41468627 CAGTGAAGGCAGGGGTGGGGTGG + Intergenic
905943768 1:41884835-41884857 CAGAGAAGGCAGGCCCAGGTGGG + Intronic
906612993 1:47216126-47216148 CCCTGAAGGCAGGCCTGGTGGGG - Intergenic
907252953 1:53155217-53155239 CTCTGAAGGCAGGTCCCGGTTGG - Intergenic
907403895 1:54241955-54241977 CTGGGCAGGCAGGGCAGGGGTGG + Intronic
907824713 1:58004345-58004367 ATTTCAAGGCAGGCCAGGGGTGG + Intronic
909539868 1:76779384-76779406 CTGTGGTGGCAGGTCCGTGGAGG - Intergenic
912307585 1:108585634-108585656 CTTTGAAGGAAGGTCTGGGGAGG - Intronic
913174576 1:116262325-116262347 ATGAGGAGCCAGGCCCGGGGAGG - Intergenic
913609505 1:120496390-120496412 CTGAAAAGGCAGGCAAGGGGTGG + Intergenic
913985952 1:143566300-143566322 CTGAAAAGGCAGGCAAGGGGAGG - Intergenic
914204315 1:145514126-145514148 CTGAAAAGGCAGGCAAGGGGTGG - Intergenic
914483437 1:148087314-148087336 CTGAAAAGGCAGGCAAGGGGTGG - Intergenic
914581685 1:149025454-149025476 CTGAAAAGGCAGGCAAGGGGTGG - Intronic
915084816 1:153378990-153379012 CAGTAAAAGCAGGCCCTGGGTGG + Intergenic
915549831 1:156625493-156625515 CTGGGAAGGCAGGTCTGGAGAGG - Exonic
916721800 1:167489935-167489957 CTGGGCAGCCAGGCCCAGGGAGG + Intronic
917515142 1:175700915-175700937 CTGAGAAATCAGGCTCGGGGAGG - Intronic
918045963 1:180941230-180941252 CTGTGACGTCAGGCCAGGCGGGG - Exonic
918852404 1:189708945-189708967 GAGTGAAGGCACGCCCGGTGGGG - Intergenic
920033255 1:203049653-203049675 CTGTGCCAGCAGACCCGGGGTGG - Intronic
920277811 1:204820871-204820893 CTGAGAGGCCAGGCCCGAGGTGG - Intergenic
920700186 1:208212083-208212105 CTGTGAAGGCATCCCAGAGGAGG + Intronic
922706635 1:227793902-227793924 CTGGGAAGCCAGGCCATGGGAGG + Intergenic
924582609 1:245335319-245335341 CTGGGATGCCAGGCCAGGGGAGG - Intronic
1063042023 10:2351682-2351704 CTGTGAACCGAGGCGCGGGGTGG + Intergenic
1063224736 10:4005112-4005134 AGGTTAAGGCAGGCCCTGGGAGG - Intergenic
1063949864 10:11212337-11212359 CTGTGAAGGCAGGCCCGGGGGGG - Intronic
1067738998 10:48880862-48880884 CTGGAGATGCAGGCCCGGGGAGG + Intronic
1069915037 10:71782209-71782231 CTGAGAAGGCAGGCGCTGGCGGG - Intronic
1070916797 10:80160401-80160423 CTGTGAAAGCAGGCACAGGGTGG - Intronic
1071468360 10:85961265-85961287 CTGTGAAGGGAGGCAGGGGCAGG - Intronic
1072608600 10:97002455-97002477 CTGTGAAGTCAGGGCTGGGTGGG - Intronic
1072725879 10:97813614-97813636 CTCTTCAGGCAGGCCAGGGGTGG - Intergenic
1072927874 10:99632369-99632391 CTGTGGAGGCTGGCAGGGGGTGG + Intergenic
1073805048 10:107088399-107088421 ATCTGAAGGCAGGCCCTGGGGGG + Intronic
1074159013 10:110821847-110821869 TTGTGAAGGCAGCCCCCTGGAGG + Exonic
1075782566 10:125026675-125026697 CTGCGGAGGCAGGACCGGGGGGG - Exonic
1076470255 10:130713735-130713757 CTGGGAAGGTAGGCCCAGTGGGG + Intergenic
1076494200 10:130886145-130886167 CAGTGAAGGCAGGCACCTGGTGG - Intergenic
1077034620 11:488662-488684 CTGCGAGGGCAGGGCCGGGTGGG + Intronic
1077073193 11:687150-687172 CTGCAAAGGCAGACCCGTGGTGG - Intronic
1077124438 11:926144-926166 CTGGGAGCGGAGGCCCGGGGCGG + Intronic
1077147617 11:1053019-1053041 CTGTGACCGCAGGCCTGGCGGGG + Intergenic
1077230214 11:1455325-1455347 CTGGGGAGGCAGGCTGGGGGCGG - Intronic
1077364185 11:2154894-2154916 CTGTGGAGGCCGGGCTGGGGTGG + Intronic
1078153152 11:8776081-8776103 CTGTGTGGGCAGGTCTGGGGAGG - Intronic
1079076598 11:17388741-17388763 CTGGGAAGGCAGGCTGGGCGGGG - Intronic
1079114953 11:17634944-17634966 CTGTGGTGAGAGGCCCGGGGTGG + Exonic
1081151571 11:39639282-39639304 CTATGAAAGCAGGCCGGGTGCGG + Intergenic
1081469810 11:43359206-43359228 CTGTGAGGGTAGGCTGGGGGCGG - Intronic
1081659440 11:44878973-44878995 CTGTGAAGCCAGCCCTGGGGAGG - Intronic
1081773665 11:45664395-45664417 GTGAAAGGGCAGGCCCGGGGTGG + Intronic
1081850806 11:46274058-46274080 CTCAGCAGGCAGGCCCTGGGTGG - Intergenic
1082067401 11:47911759-47911781 TTGGGAAGGCAGGCCAGGCGTGG + Intergenic
1088919412 11:114250550-114250572 GTGTGAAGGGAGGCCCGCGGCGG + Exonic
1088935928 11:114400369-114400391 TTGTGAAGGCAGGCCCTTCGCGG + Exonic
1089121238 11:116137173-116137195 CTGAGAAAGCTGGGCCGGGGCGG - Intergenic
1089171343 11:116513757-116513779 CAGTGGAGGAAGGCCCGGGTGGG - Intergenic
1089692990 11:120198151-120198173 CGCTGGAGGCAGGCCTGGGGAGG + Intergenic
1090363140 11:126187013-126187035 CTGTGAAGGGCGTCCCGGGCTGG + Intergenic
1092191568 12:6525032-6525054 ATGGGAAGGAAGGCCCGTGGAGG + Intronic
1096396395 12:51269861-51269883 CGGCGAAAGCAGGCCCGGAGGGG - Intronic
1096692174 12:53328106-53328128 CTGTCAGGGCAGCCCTGGGGTGG + Exonic
1102372697 12:112395526-112395548 CTTTTAAGGCAGGCCTGGTGGGG - Intergenic
1104587314 12:130057692-130057714 CTGTGAAGACAGAGCCGAGGCGG + Intergenic
1104796935 12:131526629-131526651 ATGTGAAGGCAGGCCGGGCGTGG - Intergenic
1105396929 13:20044757-20044779 ATGTGAAGACAGGCCAGGCGCGG + Intronic
1105544001 13:21338819-21338841 CTGTGGAGGCAGGTCGGGTGGGG + Intergenic
1106434094 13:29708523-29708545 GTGTGAAGGTAGGCGTGGGGGGG - Intergenic
1108157541 13:47601547-47601569 ATGTGAAGGCAGGGATGGGGAGG - Intergenic
1111105686 13:83642630-83642652 CTGTGAAAGCAGCCCGGAGGAGG - Intergenic
1112433269 13:99372085-99372107 CTGTGCAGGCAGGCGGTGGGAGG + Intronic
1112670784 13:101635271-101635293 TTTTGAAGGTAGGCCAGGGGTGG - Intronic
1113637456 13:111929417-111929439 CTGTGAAGGGGGGCCAGAGGCGG + Intergenic
1113913870 13:113859788-113859810 CTGTCAAGGCAGGGCAGGGGAGG + Intronic
1114563721 14:23612499-23612521 CTGTGAAGGCAGGCCTGACCTGG + Intergenic
1114564928 14:23623657-23623679 CTGTGAAGACAGGACAGAGGAGG - Intergenic
1114931614 14:27475517-27475539 CTGTGAAGGCAGTTCCTGGTTGG - Intergenic
1115780071 14:36759183-36759205 ATGTGAAGGCAGGCCTGCTGGGG - Intronic
1117567634 14:57011419-57011441 CTCTGAGGGCAGGACCGAGGTGG + Intergenic
1119418652 14:74493338-74493360 CTGTCGGGGCGGGCCCGGGGAGG + Exonic
1119421374 14:74509719-74509741 CTGTGAAGGTAACCCTGGGGAGG - Exonic
1119765036 14:77182565-77182587 CGGTGAAGGCAGTGCCTGGGAGG - Intronic
1120902682 14:89589624-89589646 CTGTGAAGGCAGCCCAGGACTGG + Intronic
1121313395 14:92947101-92947123 CTGTGATGGCAGGCAAGTGGGGG - Intronic
1121467598 14:94126106-94126128 CTGTGCAGGCAGTCCTTGGGAGG + Intergenic
1125589074 15:40843738-40843760 CTGGGAAAGCAGGCCCCGGCCGG + Intergenic
1125729022 15:41882495-41882517 CAGTGAAGGCAGAACAGGGGAGG + Intronic
1126579906 15:50233167-50233189 AGGTGAAGGCAGGCACAGGGAGG - Intronic
1126940397 15:53759733-53759755 CTGCGGGGGCAGGACCGGGGCGG - Intronic
1127279426 15:57476202-57476224 CCGTGTAGGCAGGCCAGGGCGGG + Intronic
1128199440 15:65792172-65792194 CTGAGACGGCAGGCCTGGGCGGG - Intronic
1128674815 15:69600741-69600763 CTGTGAACACAGGCCTGGGCAGG - Intergenic
1129595875 15:76963761-76963783 CTGGGAAGGCAGGTCAGGCGGGG + Intergenic
1131995224 15:98126558-98126580 ATCTGAGGGCAGGCCCTGGGAGG + Intergenic
1132547863 16:541437-541459 CGGCAAAGGCAGGGCCGGGGAGG + Intronic
1132626735 16:894946-894968 CTGGGCAGGGAGCCCCGGGGCGG + Intronic
1132672671 16:1108140-1108162 CTGTGTGGGAAGGCCCAGGGCGG - Intergenic
1132672851 16:1108781-1108803 CTGAGAGGGCAGGCTCTGGGAGG + Intergenic
1134684738 16:16150547-16150569 CTGTGAGGTCAGGCCGGGGCGGG + Intronic
1136414725 16:30096173-30096195 CTGCGAACCCGGGCCCGGGGGGG - Exonic
1138484469 16:57328960-57328982 CAATGAAGGCAGGCCAGGTGCGG - Intergenic
1141888850 16:86912940-86912962 CTGTGGAGGCAGCCACGGGATGG - Intergenic
1142640325 17:1281595-1281617 CTGTGGAAGCAGGGCCGGGCAGG + Intronic
1143053368 17:4144350-4144372 CTGTGAGGGTAGGGGCGGGGCGG - Intronic
1143241222 17:5444737-5444759 CTGTGAAGGTAGGGCTGGGAGGG + Intronic
1145059614 17:19724473-19724495 CTGTGAAGCCAGCCCAGGTGCGG + Intergenic
1145265909 17:21379520-21379542 CTCCAAGGGCAGGCCCGGGGAGG - Intronic
1146157185 17:30534614-30534636 CTGTCAAGGCAGCAGCGGGGAGG + Intergenic
1146179382 17:30687549-30687571 TTGTGGGGGCAGGCGCGGGGCGG - Intergenic
1147337917 17:39738281-39738303 CGGTGATGTCAGGCCAGGGGCGG + Intronic
1147374512 17:40015868-40015890 CTGTGGAGGGAAGCCCGGTGGGG + Intronic
1147566276 17:41538170-41538192 CTGTGAAGGCAGGGCCCAGGTGG - Intergenic
1147939471 17:44036127-44036149 CAGCGGAGGCAGGCCGGGGGAGG - Exonic
1149560590 17:57605412-57605434 CAGTGTAGGCAGGGCCAGGGAGG + Intronic
1149994334 17:61399131-61399153 CGGTGAAGGCGGGCGCGGGTAGG + Intergenic
1150000764 17:61438012-61438034 CTGTAAAGTCAGGCCAGGTGTGG + Intergenic
1150111368 17:62503346-62503368 ATGTTAAGCCAGGCCCGGTGCGG - Intronic
1150526963 17:65933896-65933918 CTGTTAAGGGAGGCCAGGTGTGG + Intronic
1151343936 17:73490056-73490078 TCGTGGAGGAAGGCCCGGGGTGG - Intronic
1151727421 17:75892961-75892983 CTCTGGAGGCTGGCCTGGGGTGG - Intronic
1151738648 17:75963409-75963431 CTGTGACTGCAGGCCGGGCGCGG + Intronic
1151969707 17:77451344-77451366 CTGGGAAGGGAGGCTCGGTGGGG - Intronic
1151989804 17:77566985-77567007 CGGTGAAGGCACACCAGGGGTGG + Intergenic
1153841434 18:9011541-9011563 CTGGGAAGGCAGGGCTGTGGTGG + Intergenic
1154313436 18:13284916-13284938 CTGTGAGGGCAGTCGCAGGGAGG + Intronic
1157179156 18:45480413-45480435 CTGTGGAGACAGGCACGGGCAGG - Intronic
1157412939 18:47479063-47479085 CAGTGAAGGGAGGCCTGGGTGGG - Intergenic
1157582350 18:48781028-48781050 CCGTGAAGGCAGGGATGGGGGGG - Intronic
1157582783 18:48782973-48782995 CTGGGAAGCCAGGCCTGGGCAGG - Intronic
1157762224 18:50273533-50273555 CTGGGAAGGCAGGACAGGGTGGG + Intronic
1158389701 18:57035028-57035050 CCATGTAGGCAGGCCCGAGGAGG - Exonic
1160227657 18:77023754-77023776 CTGGGGAGGCTGGCCCTGGGAGG + Intronic
1160863028 19:1245578-1245600 CCGTGCTGACAGGCCCGGGGCGG - Intergenic
1160879471 19:1312972-1312994 CTGTGACGGCAGGCGGGTGGGGG - Intergenic
1160947199 19:1649135-1649157 CGGAGCAGGCAGGCCCGGTGGGG - Intronic
1161323755 19:3653203-3653225 CTGGGCAGGCAGGGCCAGGGAGG - Intronic
1161510816 19:4670110-4670132 GAGTGCTGGCAGGCCCGGGGAGG - Intronic
1161776896 19:6268437-6268459 CTAGGAAGACAGCCCCGGGGAGG + Intronic
1162495349 19:11020235-11020257 CTGTGAAGGGAGTCCCAGCGTGG + Intronic
1163407077 19:17129464-17129486 CTGTCCAGGCAGGTCCAGGGAGG + Intronic
1163783300 19:19261627-19261649 TGGGGAAGGCAGGCCCGGGAGGG - Intronic
926170155 2:10548115-10548137 CTGTGAAATAAGGCCCCGGGTGG - Intergenic
926370924 2:12177965-12177987 CTGTGGAGCCAGCCCAGGGGAGG + Intergenic
926405792 2:12551480-12551502 ATGTGAAGGAAGGGCTGGGGAGG - Intergenic
926645649 2:15287660-15287682 ATGTGTAGGCAGTCCCGTGGAGG + Intronic
927502838 2:23593739-23593761 CTGTAAGGGCAGCCCCTGGGAGG - Intronic
927637604 2:24827507-24827529 CTGTGAGTGCAGGCCAGGAGGGG + Intronic
930710065 2:54542626-54542648 CTGTGAAGGAAGGCACAGGGAGG + Intronic
932161681 2:69465917-69465939 CTGTGCAGGCAGCTCCTGGGAGG + Intronic
932419234 2:71591848-71591870 CTGTGCAGCCAGGTGCGGGGTGG + Intronic
936091963 2:109507259-109507281 CTGTGAGGCCCGGCCAGGGGTGG - Intergenic
937274453 2:120674950-120674972 CTGTGAAGGCAGGGCCAGACAGG - Intergenic
937302525 2:120852041-120852063 CTGGAAAGGCAGGCCAGAGGTGG + Intronic
938264074 2:129913757-129913779 CTCTGGAGGCAGCCCAGGGGTGG + Intergenic
938427408 2:131203004-131203026 CTGTGAGGACGGGCCTGGGGTGG - Intronic
938556609 2:132430356-132430378 CTGGAAAGGCAGGCTGGGGGTGG + Intronic
940612290 2:156006783-156006805 CTGAGCCTGCAGGCCCGGGGTGG + Intergenic
943238086 2:185348023-185348045 CTGTGAAGGCAGCCAAGAGGGGG + Intergenic
943645938 2:190408210-190408232 CTGTGAGGCCGGGGCCGGGGAGG + Intergenic
943754527 2:191544145-191544167 CTGTGAAGGCAAGAACGTGGCGG - Intergenic
946019982 2:216634108-216634130 CGCGGAAGTCAGGCCCGGGGAGG + Intronic
946479512 2:220040673-220040695 CTGAGAAAGCAAGCCCAGGGAGG + Intergenic
946924744 2:224615660-224615682 CTGTGAAGGCCTGCCCAGGGAGG - Intergenic
947716125 2:232339687-232339709 CTGAGCATGCAGGGCCGGGGTGG + Intronic
947869996 2:233429749-233429771 CGGCAAAGGCAGGCCCGGAGGGG - Intronic
948230441 2:236345279-236345301 CTGTGAAGGAAGGGACGTGGTGG - Intronic
948456402 2:238106506-238106528 CTGGAGAGGCAGCCCCGGGGTGG - Intronic
948503567 2:238411825-238411847 CGGGGAAGGCAGGATCGGGGGGG + Intergenic
948909023 2:240993800-240993822 CCGTGCAGGCAGGCCTGGGCTGG - Intergenic
1168786648 20:545120-545142 CTGTGAAGGCAGGGCTGTGGAGG - Intergenic
1169143404 20:3238381-3238403 ATGTGAATGCAGGCGCGGGGCGG + Intronic
1169211280 20:3767534-3767556 CCGTGATGGCAGGGCTGGGGTGG - Intronic
1170120062 20:12901762-12901784 AGGTGAAGGCAGGCCAGGTGTGG - Intergenic
1170881341 20:20298817-20298839 GTGTTCAGGCAGGCCCAGGGTGG + Intronic
1170898867 20:20440727-20440749 CTGCCAAGGAAGGCCCGGGCCGG - Intronic
1170968236 20:21095280-21095302 ATGTGGAGACAGGCCCTGGGAGG + Intergenic
1171767481 20:29298004-29298026 GTGTGTTGGCAGGCACGGGGTGG - Intergenic
1172033415 20:31996482-31996504 CTGTGGAGACAGGGCAGGGGCGG - Intronic
1173098529 20:40061417-40061439 CTGTGAAAGCAGCCCAGAGGGGG + Intergenic
1173161335 20:40654690-40654712 CATTGAAGGCAGGCCCGTAGTGG - Intergenic
1173251425 20:41366077-41366099 GAGAGAAGGGAGGCCCGGGGCGG + Intronic
1175268022 20:57714283-57714305 CCGTCCAGGCAGGCCGGGGGTGG - Intergenic
1175429663 20:58892099-58892121 CTGAGCGGGCAGGCCGGGGGAGG - Intronic
1175782017 20:61688985-61689007 CTGCGAAGGCAGGTCCAGTGGGG - Intronic
1175971922 20:62690816-62690838 CTGTGACGGCAGGCCCGGGAGGG - Intergenic
1176385625 21:6137489-6137511 CTGTGAGGGCAGGCTCTGGCTGG + Intergenic
1178853926 21:36235427-36235449 ATGTGAAGGAAGGCCCGGCTCGG + Intronic
1179295719 21:40060552-40060574 CTGGTGAAGCAGGCCCGGGGTGG + Intronic
1179456869 21:41506564-41506586 CTGTGAAGGGAGGACCTGGTGGG - Intronic
1179630129 21:42672604-42672626 CTTTGCAGGCAGGCCCCAGGTGG - Intronic
1179737848 21:43400763-43400785 CTGTGAGGGCAGGCTCTGGCTGG - Intergenic
1179964849 21:44796934-44796956 CAGTGAAGGCAGGATGGGGGTGG - Intronic
1180141707 21:45897259-45897281 CTGTGAAGGGAGGCCAGTGGTGG - Intronic
1180686422 22:17670800-17670822 CTGTGAAGCCAGACCTTGGGTGG + Intronic
1180841817 22:18962441-18962463 CTGTGAAGGTTGGGCAGGGGTGG + Intergenic
1181059682 22:20276423-20276445 CTGTGAAGGTTGGGCAGGGGGGG - Intronic
1181669560 22:24419827-24419849 ATGTGAAAGCAGGCCCTGAGGGG - Intronic
1182422296 22:30254411-30254433 CTGAGCAGCCAGGCCCAGGGGGG + Intergenic
1182532373 22:30969832-30969854 CTCTGGCGGCAGCCCCGGGGTGG + Intergenic
1183776842 22:39971640-39971662 ATGTGAAGGCAGGACGGGGTTGG + Exonic
1183929987 22:41230376-41230398 CTGTGAAGGCTGGACGGTGGAGG + Exonic
1184405586 22:44298771-44298793 CGGGGAGGGCAGGCCCGGCGAGG + Intronic
1184783748 22:46661984-46662006 CTGTGAAGCCAGGCGGGGGCTGG - Intronic
1184804982 22:46788928-46788950 CTTTGAAGGAAGGCCGGGTGTGG + Intronic
1184922052 22:47612773-47612795 CAGGGAAGGCAGGCTCAGGGCGG + Intergenic
1185258325 22:49848740-49848762 CGGTCAAGGCCGGCCCGGGAGGG - Intergenic
950658251 3:14450665-14450687 CTGTGAAGGCAGGTCACAGGAGG - Intronic
951562510 3:23982408-23982430 CTGTGAGGGCAGGGCCAGTGAGG + Intergenic
951744301 3:25960420-25960442 CTGTAAAGGAATGCCCGGTGAGG + Intergenic
952702243 3:36339705-36339727 CTGGCAAGGCAGGGCTGGGGTGG + Intergenic
953418539 3:42736782-42736804 TTGTGCCTGCAGGCCCGGGGCGG - Intronic
953768614 3:45762303-45762325 CTGATCAGGCAGGCCAGGGGAGG - Intronic
954686301 3:52372095-52372117 CAGTGGAGGCAGGGCCTGGGGGG - Intronic
954707467 3:52488735-52488757 ATGTAGAGGGAGGCCCGGGGGGG - Intronic
954713841 3:52517453-52517475 CCTTCAGGGCAGGCCCGGGGAGG + Intronic
959973468 3:112432306-112432328 CTGTGAAGGCAGCCAGAGGGAGG + Intergenic
960169499 3:114442091-114442113 CTTTGAAGACAGGCCAAGGGAGG + Intronic
960496793 3:118384396-118384418 CTGTGAAAGCAGGCAGGAGGGGG + Intergenic
961764678 3:129200214-129200236 AGGTGAAAGCAGGCACGGGGTGG - Intergenic
963091382 3:141486901-141486923 CGGTGAATGGAGACCCGGGGGGG + Intergenic
965264986 3:166531694-166531716 CTGTGAAGGCAGCCAGGAGGGGG - Intergenic
966891313 3:184409485-184409507 CTGGACAGGCAGGCCCGGGGCGG + Intronic
967286466 3:187875592-187875614 CTCTGCAAGCAGGCCCGGCGCGG - Intergenic
968458319 4:710220-710242 CTCTGAAGGCTGGACTGGGGAGG + Intronic
968725776 4:2247222-2247244 CTGTGACGGCGGGCCCGGTGTGG + Intergenic
968762608 4:2450428-2450450 CCATGAGGGCAGGCCCGGGCTGG + Intronic
972532205 4:39971444-39971466 CCTTAAAGGCAGGCCCGGTGCGG - Intronic
975853857 4:78601950-78601972 ATGAGAAGGCAGGCCAGGCGCGG + Intronic
976390152 4:84498149-84498171 CTGTGCAGGGCGGCCAGGGGAGG + Exonic
980268630 4:130553972-130553994 CTGTGAAGAAAGGCCAGGCGTGG + Intergenic
980596578 4:134962647-134962669 CTGTGAAAGCAGCCCGGAGGGGG + Intergenic
983843687 4:172488819-172488841 CTGCGAAGGCAGTCCTGGGGTGG + Intronic
984865588 4:184277617-184277639 CTGTGAAAGCAGGCAGGAGGGGG + Intergenic
986102535 5:4627035-4627057 CTGTGAAGCCAATCCCAGGGGGG - Intergenic
987090021 5:14502120-14502142 CTGTGAAAGGAGGCGTGGGGAGG + Intronic
987455344 5:18138247-18138269 CTGTGAAGGCAGCCAGGAGGGGG - Intergenic
991308613 5:65210160-65210182 CTATGAAGGCCGGCCGGGCGCGG + Intronic
998505377 5:142668019-142668041 CTGAGCAGGCAGGCCCCTGGGGG + Intronic
998822211 5:146067255-146067277 CGGGGAAGGCAGGCCTGGTGTGG - Intronic
1001424528 5:171614779-171614801 ATGTAAGGGCAGGGCCGGGGTGG - Intergenic
1001774252 5:174316741-174316763 GTGTGCAGGCAGGGCTGGGGAGG + Intergenic
1002715500 5:181224223-181224245 CTGTGGGGGCTGGCGCGGGGTGG + Exonic
1002789496 6:426946-426968 CTGCCAAGGCAGGCCTGGGGTGG + Intergenic
1003525222 6:6891544-6891566 CTGTGAAGGCAGGGAGAGGGAGG + Intergenic
1003540703 6:7015915-7015937 CTGTGAAGGCAGGCCAAAAGGGG - Intergenic
1004000869 6:11595960-11595982 CTGACAAGGCAGGCCTGGTGAGG - Intergenic
1007399708 6:41596870-41596892 CTGTGAAGGCAGACACTGGGGGG + Intronic
1009532901 6:64843382-64843404 CTGTGAAAGCAGCCCGGAGGTGG + Intronic
1010512607 6:76739003-76739025 CTCTGAAGGCAGGCTGGGTGTGG + Intergenic
1013106834 6:107032920-107032942 ATGTGAAAGCAGGTCCGGGGAGG - Intronic
1015792087 6:136973918-136973940 CTGCTAAGGCCGGCCCGGCGCGG - Intergenic
1015936522 6:138410224-138410246 CTGGCAAGGCAGGCACGTGGGGG + Intronic
1016721841 6:147307117-147307139 TTGTTAAGGCAGGCCTGGGAAGG + Intronic
1016805445 6:148207550-148207572 GTGTGAAAGAAGGCCCTGGGAGG + Intergenic
1017588359 6:155951502-155951524 CTGAGAATGCAGGCTTGGGGTGG - Intergenic
1018742183 6:166738362-166738384 CTTTGAAGGAAGGCCTCGGGGGG + Intronic
1019347617 7:538550-538572 CTGGGGTGACAGGCCCGGGGGGG - Intergenic
1020259213 7:6521293-6521315 CTTAGGAGGCAGCCCCGGGGAGG + Intronic
1022285962 7:28956526-28956548 CTGTGGAGCCGGGCCCGCGGCGG + Exonic
1022510311 7:30931215-30931237 TTGTGAAGTCAGGCACTGGGAGG + Intergenic
1025176506 7:56804854-56804876 GTGTGGAGGCAGCCCCGAGGTGG - Intergenic
1025695285 7:63771532-63771554 GTGTGGAGGCAGCCCCGAGGCGG + Intergenic
1026458945 7:70596386-70596408 CTCGGAAGCCAGACCCGGGGAGG + Intronic
1029515743 7:101021978-101022000 CTGTGATGGCAGGGCCGGGCTGG - Intronic
1032040571 7:128557250-128557272 ATGTTAAGCCAGGCCCGGTGCGG - Intergenic
1033664915 7:143431296-143431318 CTGTAAAGGCAGACCCAGGATGG - Intergenic
1034182195 7:149147612-149147634 CGGGGAAGGCAGGGCCGGGTCGG + Exonic
1034337819 7:150334719-150334741 CTGAGAAGGGAGCCCCGGGCCGG + Intronic
1037329480 8:17730185-17730207 ATGTGAAAGCAGGCCGGGGGTGG + Intronic
1037603947 8:20421956-20421978 TGGTGAAGGTAGGCCCAGGGCGG - Intergenic
1037781379 8:21871580-21871602 CTGTCCAGGCAGCCCCGAGGAGG + Intergenic
1038412292 8:27368023-27368045 CTGTGGAGTCAGGCCCAGGCTGG + Intronic
1039082282 8:33745070-33745092 CTGTGAAAGCAGCCCGGAGGTGG - Intergenic
1039238092 8:35525095-35525117 CAGCGGAGGCAGGCCGGGGGAGG - Intronic
1040284719 8:46093907-46093929 CTGTGCAGGCAGGCCTGTGCAGG + Intergenic
1040545790 8:48396987-48397009 AGGTGAAGGCAGGGCGGGGGCGG - Intergenic
1041098544 8:54373498-54373520 CTGGAAAGGCAGGCCTGGGGAGG + Intergenic
1041673601 8:60516815-60516837 CGGGCAAGGCAGGCGCGGGGCGG + Intergenic
1042306285 8:67336838-67336860 CTGACAAGGCAGGCCGGGCGCGG + Intronic
1048260457 8:132940686-132940708 CTTTGAAGACAGCCCCTGGGTGG + Intronic
1049646179 8:143736794-143736816 CAGTGAAGGCGGGGCTGGGGTGG - Intergenic
1050442702 9:5682337-5682359 CTTTTAAGGCAGGCCTGGTGGGG + Intronic
1054758790 9:68985710-68985732 CTGTGAGTGCAGGCCCGTGGAGG - Intronic
1055356962 9:75447496-75447518 CTGTGAAAGCAGGCCTGAAGTGG + Intergenic
1056717298 9:89042717-89042739 CTGTGAAGGAAGCCCAGGGTGGG + Intronic
1056925151 9:90828245-90828267 CTGTGAAGGCCTGGGCGGGGCGG - Intronic
1058604558 9:106706815-106706837 TTGTGAAGGGAGGCCAGGTGTGG - Intergenic
1058707534 9:107649856-107649878 CTTGGAGGGCAGGCCGGGGGAGG - Intergenic
1059628363 9:116091930-116091952 CTGTGAAGGCAGCCAAGGGCAGG + Intergenic
1060418542 9:123450408-123450430 CTGTGAACTCAGGCCTGGTGGGG + Intronic
1062085209 9:134644574-134644596 CTGGAGAGGCAGGCGCGGGGGGG + Intronic
1062573349 9:137195467-137195489 CTGTGCAGGCAGATCCTGGGTGG - Intronic
1186787745 X:12969270-12969292 CTGTGAAGCCAGTCCTGGAGAGG + Intergenic
1188771901 X:34163151-34163173 CTGTGAAGGCTTGCCCTGTGGGG + Intergenic
1189274938 X:39778731-39778753 CAGAGAAGGCAGGCCAGGGCTGG + Intergenic
1190214787 X:48472737-48472759 CAGTAGAGGCAGGCCCTGGGAGG - Intergenic
1190931143 X:54950618-54950640 CTGTGTGGGCAGGGCCGGGCTGG + Intronic
1192056521 X:67779329-67779351 CTGTGAAGGCAGGCCAGGGAGGG + Intergenic
1192496091 X:71617460-71617482 CTGTGAGGGCGGGAACGGGGAGG + Exonic
1192509952 X:71715782-71715804 CAGTGAAGGCAGTCCCAGAGCGG - Intronic
1192516745 X:71765771-71765793 CAGTGAAGGCAGTCCCAGAGCGG + Intronic
1192669837 X:73127990-73128012 CTGTGGAAGCTGGCCTGGGGTGG + Exonic
1195692818 X:107642230-107642252 ATGGGAAGGCAGGCCCAGTGTGG - Intronic
1197732557 X:129823699-129823721 CTGCAATGGGAGGCCCGGGGAGG + Exonic
1198834986 X:140795456-140795478 CTGTGAAAGCAGCCGGGGGGTGG - Intergenic
1200122151 X:153796218-153796240 CTGTGAAGGAAGGCTGGGGAGGG - Intronic