ID: 1063952329

View in Genome Browser
Species Human (GRCh38)
Location 10:11234836-11234858
Sequence AAGTGCCTTTTTAACTCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 192}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063952329_1063952332 17 Left 1063952329 10:11234836-11234858 CCTGCAGAGTTAAAAAGGCACTT 0: 1
1: 0
2: 1
3: 14
4: 192
Right 1063952332 10:11234876-11234898 CCTTAACTGAATGAAGAAGAGGG No data
1063952329_1063952330 16 Left 1063952329 10:11234836-11234858 CCTGCAGAGTTAAAAAGGCACTT 0: 1
1: 0
2: 1
3: 14
4: 192
Right 1063952330 10:11234875-11234897 TCCTTAACTGAATGAAGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063952329 Original CRISPR AAGTGCCTTTTTAACTCTGC AGG (reversed) Intronic
900152995 1:1187929-1187951 AAGTGTAATTTTCACTCTGCTGG - Intronic
904721444 1:32512348-32512370 AAGTGGCTTTTTAAATCTGAAGG + Intronic
905098853 1:35500562-35500584 AAATGCCTTTGCAGCTCTGCAGG + Intronic
908684229 1:66697017-66697039 AAGTGCCTTGTTTACTTTCCTGG - Intronic
909451876 1:75806570-75806592 TAGTTCTTTTTTAACTCTGATGG + Intronic
909664166 1:78115337-78115359 AAGTTCATTTTTCACCCTGCAGG + Intronic
910293115 1:85617643-85617665 AAGGGCCTTTCTCACTCTGAAGG - Intergenic
910526764 1:88187737-88187759 AAGTGCATGTCTAATTCTGCTGG - Intergenic
910805659 1:91188065-91188087 AAGTGTCTGTTGAACCCTGCTGG + Intergenic
913433483 1:118821981-118822003 AAGTGACTTTTTACCACTGGAGG - Intergenic
916748235 1:167700913-167700935 AAGTGACTTTTCAACCCTTCAGG - Intronic
918292771 1:183124780-183124802 AAGTGCATCTATAACACTGCTGG + Exonic
918485719 1:185026649-185026671 AAGTGACTTTTTAATTTTGCAGG - Intergenic
918647189 1:186918346-186918368 AAGGGCCTGTTAAACTCTGGGGG - Intronic
919579245 1:199350602-199350624 AAGTGGATTTTCAACTATGCAGG + Intergenic
919599075 1:199600183-199600205 AAGTGCCTGTTGACCCCTGCTGG - Intergenic
919680807 1:200432647-200432669 AAATGCCTTTATAATTCTGAGGG - Intergenic
1063735874 10:8753704-8753726 AACTGCCTTTTTTTCTCCGCTGG + Intergenic
1063952329 10:11234836-11234858 AAGTGCCTTTTTAACTCTGCAGG - Intronic
1064397222 10:14991668-14991690 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1064400119 10:15014138-15014160 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1065609141 10:27453563-27453585 ATGAGCCATTTTAACTCTGGTGG + Intergenic
1066390402 10:34973491-34973513 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1066930183 10:41749266-41749288 AAATAAATTTTTAACTCTGCGGG - Intergenic
1076100721 10:127775527-127775549 AAGTGCCTTTCTGTCTCAGCTGG + Intergenic
1076194902 10:128510845-128510867 AAGTGGCTTCTGAACACTGCCGG + Intergenic
1077280785 11:1744413-1744435 AGCTGCCTTTTTAACCCTTCTGG - Intronic
1077589034 11:3477521-3477543 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1077869682 11:6251317-6251339 AAGTGCCTTCTGCTCTCTGCTGG - Intergenic
1077977027 11:7257821-7257843 AAGTGTGTTTTCATCTCTGCGGG + Intronic
1078099989 11:8324338-8324360 AAGGGCCTTTTTATCTGTGCAGG + Intergenic
1078600291 11:12724636-12724658 AGGTGCCTTTGAAACACTGCAGG + Intronic
1078884541 11:15487207-15487229 AAATTCCTTTCTAACTCAGCTGG - Intergenic
1079795499 11:24797799-24797821 AAGTTCTTTTATAAATCTGCTGG + Intronic
1080741707 11:35071046-35071068 TATTGTCTTTTTAAGTCTGCAGG - Intergenic
1081315721 11:41626715-41626737 AAGTGCCTTTTTAACTGAAGGGG - Intergenic
1081592996 11:44438035-44438057 AGGTGCCTGTTGACCTCTGCTGG - Intergenic
1084244729 11:67849144-67849166 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1084827955 11:71745412-71745434 AAGAGCCTATTGAACTCTGGGGG + Intergenic
1084847464 11:71911683-71911705 AAGGGCCTATTGAACTCTGGGGG + Intronic
1087561966 11:99802341-99802363 AACTGCCTGATTAACTCTGGAGG + Intronic
1088673864 11:112171454-112171476 AAGTGTTTTTTTTACACTGCCGG + Intronic
1090430194 11:126639511-126639533 ATCTGCCTTCTTAACTCTCCTGG - Intronic
1090480112 11:127060583-127060605 AAGTGAATTTTTGACTGTGCAGG + Intergenic
1091560111 12:1605723-1605745 AAGTGCCATTTTATGTCTGTGGG + Intronic
1092415293 12:8286289-8286311 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1092432376 12:8419890-8419912 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1093916865 12:24813013-24813035 AAGTGCCCTTTCAAATCTGCTGG - Intronic
1096325830 12:50660629-50660651 AAGTGGCTATTTAACACAGCAGG - Intronic
1097566448 12:61275499-61275521 AAGTGTATTTTTGACTCTGTAGG + Intergenic
1098748643 12:74269065-74269087 AAGGGCCTGTTAAACTCTGGGGG + Intergenic
1102675410 12:114654827-114654849 CAGTGACTTTTTAACTTTTCAGG + Intergenic
1103799843 12:123531093-123531115 AAGAGCCTTTGAGACTCTGCAGG + Intronic
1104195063 12:126528844-126528866 AAATGCCCTTTTAATTCTGTGGG + Intergenic
1104312359 12:127664901-127664923 AATTGCCTTTTGTACTCTACTGG + Intergenic
1106484292 13:30158848-30158870 AAATGCCTTCTGAACTCAGCTGG - Intergenic
1107544157 13:41421456-41421478 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1108868547 13:54952594-54952616 AAGTGAATTTTTGACTGTGCAGG + Intergenic
1109170073 13:59084087-59084109 AAATGTCTTTTTAAATATGCAGG + Intergenic
1109803003 13:67401929-67401951 AAGGGCCTGTTAAACTCTGGGGG + Intergenic
1109991487 13:70063924-70063946 AAGTCATTTTTAAACTCTGCAGG + Intronic
1110960266 13:81612886-81612908 AAGAGCTTACTTAACTCTGCAGG + Intergenic
1112902334 13:104373420-104373442 AAGTGTCTTTTGAAATATGCTGG + Intergenic
1114260916 14:21035561-21035583 GAGAGCCTTTTTACCTTTGCTGG + Intronic
1114535773 14:23421348-23421370 AAGGTCCTTTTTAGCTCTGATGG + Intronic
1114786633 14:25607560-25607582 ATTTGCCTTTTTAACACAGCAGG - Intergenic
1115803191 14:37019543-37019565 AAATGTCTTTCTAACTCTTCAGG - Intronic
1115856184 14:37632542-37632564 AAGTGTCTGTTTACCCCTGCTGG + Intronic
1117145310 14:52831647-52831669 AAGTTCCATTATAAATCTGCTGG + Intergenic
1117493978 14:56283461-56283483 AACTGCCTTTTCCACTGTGCTGG - Intronic
1125062955 15:35446697-35446719 ACGTGGCTTTTTAACTGTGCAGG + Intronic
1125087990 15:35753650-35753672 AAATTCCTTTATAACTCTGAGGG - Intergenic
1129770769 15:78201977-78201999 AAGTGGCTTCCAAACTCTGCAGG - Intronic
1131417126 15:92270003-92270025 AAGAGCCTTTTGAAATCTGAGGG - Intergenic
1132642848 16:985487-985509 AAGTGCCTGCTGAAGTCTGCAGG + Exonic
1132938655 16:2496012-2496034 AAGTGTTTTTTTAATCCTGCAGG + Exonic
1135648654 16:24186412-24186434 AAGTGATTTTTCAACTCTGATGG + Intronic
1140184662 16:72757061-72757083 AGGTGGCTTTTTTACTCTGTTGG + Intergenic
1140254481 16:73323208-73323230 GGATGCCTTCTTAACTCTGCTGG - Intergenic
1142852271 17:2709971-2709993 AAGCCCCTTCCTAACTCTGCTGG - Intronic
1145864846 17:28234496-28234518 AAGCGCCTATTGAACTCTGGGGG - Intergenic
1146906252 17:36620143-36620165 AGGTGGCCTTTTCACTCTGCGGG + Intergenic
1148002949 17:44400762-44400784 AACTGCCTTTTTTACTCTCTGGG + Exonic
1149970203 17:61210357-61210379 CAGTGGCTTGTTAACTCTGAAGG + Intronic
1153881697 18:9426849-9426871 AACTGGCTTTGTCACTCTGCAGG - Intergenic
1156553323 18:38041304-38041326 ACATTCCTTTTTAACTCTGAAGG - Intergenic
1156997496 18:43485280-43485302 AAATGCCCATCTAACTCTGCTGG - Intergenic
1157209009 18:45725317-45725339 AAGTGCTTTTTGACTTCTGCTGG + Intronic
1158111434 18:53944419-53944441 AAATGCCCATTTAACTCTGCCGG + Intergenic
1162193292 19:8964047-8964069 AATTGCCTTTGTATCTCTGGAGG + Exonic
1162284204 19:9726110-9726132 AAGGGCCTGTTAAACTCTGGGGG - Intergenic
1162349666 19:10140970-10140992 AAGCGCCTTGTTAACTCAGGCGG + Intronic
1163943208 19:20513824-20513846 AAGGGCCTGTTAAACTCTGGGGG - Intergenic
1163966372 19:20750816-20750838 AAGGGCCTATTGAACTCTGGGGG - Intronic
931147493 2:59535123-59535145 AGATGCCTTTTTAACTCTAGTGG - Intergenic
932349946 2:71023607-71023629 AAGGGCCTATTGAACTCTGGGGG + Intergenic
932500159 2:72176146-72176168 AAGTCCATTTTTAACTCTAAAGG - Exonic
932658490 2:73631082-73631104 AATAGCCTTTTTAACTCTGAGGG - Intergenic
932665103 2:73691089-73691111 AATAGCCTTTTTAACTCTGAGGG - Intergenic
933285506 2:80380672-80380694 AAGTGCATTGTAATCTCTGCAGG - Intronic
940021164 2:149157106-149157128 GAGTGCCTTTTTCATTCTGAGGG + Intronic
940345437 2:152623524-152623546 AATGGCCTTTGTAACTCTGGAGG + Intronic
940869526 2:158848384-158848406 AAGGGCCTATTGAACTCTGGGGG + Intronic
940872202 2:158869382-158869404 AAGGGCCTATTGAACTCTGGGGG + Intergenic
940874409 2:158885370-158885392 AAGGGCCTATTGAACTCTGGGGG + Intergenic
942245871 2:174007716-174007738 ACATGCATTTTTAACTATGCAGG + Intergenic
942768206 2:179482692-179482714 AAGTCCATTTGTAACTCTGAGGG + Intronic
943232977 2:185279721-185279743 TAGTTTCTTTTTAACTTTGCAGG + Intergenic
943358649 2:186891713-186891735 AAGTGCCATTTGAACACTGTAGG + Intergenic
943398118 2:187367895-187367917 AACTGCCTCTGTAACTCTGCTGG - Intronic
945948278 2:216014727-216014749 AGGTGCCTTTTTAATTTTGATGG + Intronic
947595003 2:231405528-231405550 AAGGGCCTATTGAACTCTGGGGG + Intergenic
948967943 2:241399200-241399222 AAGTGCCTATTTAAGTCTTTCGG + Intronic
1170807799 20:19648492-19648514 TTGTGCCTTTTTAAATGTGCCGG + Intronic
1170943877 20:20872129-20872151 AAGTGACTTTTTAACCATGGGGG + Intergenic
1171408547 20:24930246-24930268 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1172211173 20:33199571-33199593 AAGAGCCTTTCCAACTCTGATGG + Intergenic
1176678986 21:9808086-9808108 AAGTGACTTATTAACACTGATGG - Intergenic
1177021300 21:15861855-15861877 AAGTGTCTTTCTACCTCTGCTGG + Intronic
1179783408 21:43716864-43716886 GAGCTCCTTTTTAGCTCTGCAGG - Intergenic
1185336946 22:50274975-50274997 CAGCGTCTTTTTCACTCTGCGGG - Exonic
949884564 3:8682968-8682990 AAAGGCCTATTTAACTCTGGGGG + Intronic
951350754 3:21604090-21604112 AAGTGTATTTTTCACTCTTCAGG - Intronic
955675009 3:61438978-61439000 GAGTTCCTTTTGAACTCTGCAGG - Intergenic
957002916 3:74907780-74907802 AAGTGAATTTTTGACTATGCAGG + Intergenic
957076184 3:75604895-75604917 AAGGGCCTATTGAACTCTGGGGG - Intergenic
959709361 3:109369754-109369776 ATGAACCTTTTTAATTCTGCTGG + Intergenic
964522395 3:157583191-157583213 AAGGGCCTGTTAAACTCTGGGGG - Intronic
965163280 3:165163473-165163495 AACTGCCTTTATTACTCTGAAGG + Intergenic
966249825 3:177852127-177852149 AAGTGCATTTTTAACTAGCCAGG + Intergenic
969729477 4:8945570-8945592 AAGCGCCTATTGAACTCTGGGGG + Intergenic
969734217 4:8976213-8976235 AAGGGCCTCTTGAACTCTGGGGG + Intergenic
969789067 4:9479509-9479531 AAGGGCCTATTGAACTCTGGGGG + Intergenic
969793804 4:9510277-9510299 AAGGGCCTATTGAACTCTGGGGG + Intergenic
970397780 4:15687275-15687297 AAGTGCCTTTTTAATTTCGAAGG - Exonic
971285352 4:25283967-25283989 AAGTGTCTTTTTAAATCTTTTGG - Intergenic
971690454 4:29827534-29827556 TAGTACCTCTATAACTCTGCAGG + Intergenic
976412472 4:84731291-84731313 AAATTTGTTTTTAACTCTGCCGG + Intronic
978540502 4:109811609-109811631 AAGTGTCTTTTCAATTTTGCTGG - Intergenic
980780151 4:137483063-137483085 AAGGGCCTGTTAAACTCTGGGGG + Intergenic
983161494 4:164421177-164421199 ACGTGCCTTTCTAACTAAGCTGG - Intergenic
984583708 4:181538932-181538954 AACTGGCTTTTTAATTCTGTTGG + Intergenic
985396563 4:189550858-189550880 AAGTGACTTATTAACACTGATGG + Intergenic
985685831 5:1281006-1281028 CCGTGCCTTTTCTACTCTGCTGG - Intronic
990469340 5:56099460-56099482 AACTGCCTATTCAACTCTGTTGG + Intergenic
990773286 5:59275721-59275743 AAGTGACTCTTTCACTATGCTGG - Intronic
991114376 5:62937413-62937435 TAGTGCCTTATTAACACTTCTGG + Intergenic
992020501 5:72619186-72619208 AAGCGCCTTTTGAATTCTGAAGG - Intergenic
992047624 5:72910479-72910501 ATTTTTCTTTTTAACTCTGCTGG + Exonic
994169419 5:96642389-96642411 AAGTGCCTTTCTAATTCCCCAGG - Intronic
995891291 5:116955048-116955070 TAGTGCCATTTATACTCTGCTGG + Intergenic
996844739 5:127886752-127886774 ATGTGAATTTTTAACTGTGCAGG + Intergenic
999380751 5:151119364-151119386 AAGAGCCTTTTCATCTGTGCCGG + Exonic
1005160309 6:22852582-22852604 AAGTGCCAATTAAACACTGCAGG + Intergenic
1006289405 6:33122979-33123001 AATTGCCTTTCTAATTCTGGGGG + Intergenic
1007020262 6:38512723-38512745 AAGTGAGTTTTTAACTCTGAAGG + Intronic
1009378318 6:62999111-62999133 AAGTGCCTTTTTATGAATGCTGG + Intergenic
1009763762 6:68041027-68041049 ATGTGCATTTGTTACTCTGCAGG - Intergenic
1010644134 6:78366331-78366353 AAGTGTCTTTTTACCTGTTCTGG - Intergenic
1018051741 6:160015395-160015417 CAGGGCCTTTTTTACTCTGGGGG + Intronic
1020307021 7:6843222-6843244 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020311497 7:6872066-6872088 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020323065 7:6954404-6954426 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1022414013 7:30162746-30162768 AAGAGCCTTTCAAACTCTGGTGG + Exonic
1023579280 7:41664099-41664121 AAGTGTCTTTTTAACTCGGGTGG - Intergenic
1024712312 7:52029843-52029865 AAGTGCCTTTTTACTTCAGTTGG + Intergenic
1029078175 7:97952166-97952188 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1030469352 7:109943788-109943810 TAGTGCCTTTTTTACTTTCCAGG + Intergenic
1032550280 7:132778363-132778385 ATGTGCCTTTTTCACTCTGCTGG + Intergenic
1033061385 7:138112021-138112043 AAGTAGATTTTTAACTGTGCAGG + Intronic
1033956487 7:146855279-146855301 AAATGCATTTTTAGTTCTGCTGG - Intronic
1036239833 8:7072337-7072359 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1036816608 8:11907281-11907303 AAGGGCCTATTGAACTCTGAGGG - Intergenic
1036903500 8:12689228-12689250 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1038799128 8:30733386-30733408 AAGGGCCTATTGAACTCTGGGGG + Intronic
1041008988 8:53523228-53523250 AAGGGCCTGTTGAACTCTGGGGG - Intergenic
1041838259 8:62241665-62241687 AAGTGCTTGTTGAACCCTGCTGG + Intergenic
1043877044 8:85497194-85497216 AAGTGCTTTTTGAACTCTACAGG - Intergenic
1044864137 8:96553087-96553109 AAGTGCCTTTTTTACATTGAGGG + Intronic
1045052688 8:98341266-98341288 GCTTGTCTTTTTAACTCTGCAGG - Intergenic
1047119293 8:121882592-121882614 AAGAGACTTCTAAACTCTGCTGG + Intergenic
1047741209 8:127808532-127808554 AAGTGCTTTTTTAAGTCTTTGGG + Intergenic
1049112507 8:140656439-140656461 AAGTGCCTTCATACCTCTGGAGG - Intergenic
1051802337 9:20949791-20949813 AAATGCCTCTTGAACTCAGCGGG - Intronic
1055130154 9:72765918-72765940 CACTGCATTTTTAACTCTTCTGG - Intronic
1056348805 9:85726693-85726715 AAGTGTCTTTTGAATTTTGCTGG - Intronic
1056917169 9:90756062-90756084 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1062224082 9:135439214-135439236 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1203664157 Un_KI270754v1:10622-10644 AAGTGACTTATTAACACTGATGG - Intergenic
1185909967 X:3972196-3972218 AAGGGCCTGTTAAACTCTGGGGG + Intergenic
1186546442 X:10454825-10454847 ATGTGCCTTTTTATAACTGCAGG + Intronic
1188505142 X:30874206-30874228 AGGTGGATTTTTGACTCTGCAGG + Intronic
1190343815 X:49319528-49319550 AAATTCCTTTTAAATTCTGCAGG + Intronic
1190344910 X:49329071-49329093 AAATTCCTTTTAAATTCTGCAGG + Intronic
1190346004 X:49338636-49338658 AAATTCCTTTTAAATTCTGCAGG + Intronic
1190347256 X:49529669-49529691 AAATTCCTTTTAAATTCTGCAGG + Intergenic
1190348355 X:49539225-49539247 AAATTCCTTTTAAATTCTGCAGG + Intronic
1190349456 X:49548781-49548803 AAATTCCTTTTAAATTCTGCAGG + Intronic
1190350560 X:49558333-49558355 AAATTCCTTTTAAATTCTGCAGG + Intronic
1190351662 X:49567892-49567914 AAATTCCTTTTAAATTCTGCAGG + Intronic
1190352762 X:49577441-49577463 AAATTCCTTTTAAATTCTGCAGG + Intronic
1190353863 X:49586988-49587010 AAATTCCTTTTAAATTCTGCAGG + Intronic
1190354965 X:49596511-49596533 AAATTCCTTTTAAATTCTGCAGG + Intronic
1191176554 X:57508216-57508238 AAGTCTATTTTTAACTCTACAGG - Intergenic
1193697266 X:84724200-84724222 TAGTACCTTGTTATCTCTGCTGG + Intergenic
1194212545 X:91086068-91086090 AAGTCTAATTTTAACTCTGCTGG - Intergenic
1197662727 X:129191483-129191505 AAGTGCTTTGTAAACTGTGCAGG - Intergenic
1201628314 Y:16039664-16039686 AAGTGCATTTCTAACTTTCCAGG - Intergenic