ID: 1063953437

View in Genome Browser
Species Human (GRCh38)
Location 10:11244892-11244914
Sequence CACCAGACACAGATGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 384
Summary {0: 1, 1: 0, 2: 4, 3: 22, 4: 357}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063953437 Original CRISPR CACCAGACACAGATGGAGGA AGG (reversed) Intronic
901886654 1:12228308-12228330 CTCCACAGACAGAAGGAGGAAGG - Intergenic
902388919 1:16091551-16091573 CACCAGGCACCGATGTGGGATGG - Intergenic
902853105 1:19177181-19177203 CATCAGACACAGGTAGAGCAGGG + Intronic
903983019 1:27203583-27203605 AACCAGAAATACATGGAGGAGGG - Intergenic
904285360 1:29450216-29450238 CACATGCCCCAGATGGAGGAGGG - Intergenic
905024159 1:34838361-34838383 CACTGGACACAGATGGAGTAAGG + Intronic
905556615 1:38890521-38890543 AACCAGACTCAGATATAGGAAGG - Intronic
906946611 1:50300182-50300204 CACCAGGCAGAGATGGAACAGGG + Intergenic
907776708 1:57522853-57522875 CACCAGAGAAAGATGAAGGCCGG - Intronic
908077935 1:60541612-60541634 TGCCAGACACAGAGAGAGGATGG + Intergenic
909150910 1:72003450-72003472 CACAAGACATAGGTGCAGGATGG + Intronic
910453864 1:87374556-87374578 CAACAGACACTGGTGGAGGGTGG - Intergenic
912364033 1:109118216-109118238 CAGTAGGCAGAGATGGAGGAAGG + Intronic
912567372 1:110597940-110597962 CAGCAGGGACAGATGGAGGTAGG - Intronic
912722690 1:112033247-112033269 CCCCAGACTGAGATGCAGGAGGG - Intergenic
913106225 1:115616411-115616433 CCCCCGACACAGAGTGAGGAAGG - Intergenic
913316977 1:117561769-117561791 CAGAAGCCAAAGATGGAGGATGG + Intergenic
913331548 1:117672062-117672084 AACCAGACACAGAGGCAGGGTGG - Intergenic
914901801 1:151715097-151715119 CACCATAGGCAGGTGGAGGACGG + Intronic
914926537 1:151893613-151893635 CATCAGGCACAGATGCAGGGGGG + Intronic
915276492 1:154792309-154792331 CACCAGTGACAGAAGGAGGTGGG + Intronic
915468540 1:156112557-156112579 CACCAGAAGCAGAGGCAGGAGGG - Intronic
916917576 1:169426490-169426512 TACCAGACACTCAGGGAGGAAGG - Intronic
918215172 1:182387082-182387104 CAGCATTCACAGATTGAGGAGGG + Intronic
918861515 1:189832249-189832271 CACTAGACACAGTTGGTAGATGG - Intergenic
919516741 1:198534289-198534311 GAGCAGACACACAGGGAGGAAGG + Intronic
919933603 1:202237087-202237109 GACCAGACACAGAGGCAGGAGGG - Intronic
923321923 1:232842785-232842807 CAAAGGAAACAGATGGAGGATGG + Intergenic
923797330 1:237170450-237170472 CACCTGGCAGAGACGGAGGAGGG - Intronic
923860727 1:237889752-237889774 CACCTGACACTAATGAAGGAAGG - Intronic
924101292 1:240605117-240605139 AACCAGACACAGCAGTAGGATGG + Intronic
1063006447 10:1975484-1975506 TTCCATACACAGATGCAGGAAGG + Intergenic
1063261183 10:4391416-4391438 CACCAGACAAAGATGCTGCAGGG + Intergenic
1063674166 10:8125130-8125152 CAACAGAAACAAAGGGAGGAGGG + Intergenic
1063953437 10:11244892-11244914 CACCAGACACAGATGGAGGAAGG - Intronic
1065142094 10:22727887-22727909 CACTGCACCCAGATGGAGGAAGG + Intergenic
1065289691 10:24217420-24217442 CATCAGACACTGATGGGGAAGGG - Intronic
1067150792 10:43731666-43731688 AAGCAGAAACAGAAGGAGGAAGG - Intergenic
1068968648 10:62939386-62939408 CACCAGTGAGAGATGGAGTAGGG - Intergenic
1069945017 10:71979528-71979550 GGCCAGGCACAGATGGGGGAGGG + Intronic
1070329501 10:75407600-75407622 CTCCAGACACAGGCGCAGGAGGG - Intergenic
1071032712 10:81204226-81204248 CACAAGAGAAAGATGGAGGCCGG - Intergenic
1071391147 10:85176440-85176462 CACCAAACACACATGGCCGATGG - Intergenic
1071464321 10:85925673-85925695 CACCAGATACTGCTGAAGGAGGG + Intronic
1071693790 10:87850969-87850991 CACCAAACCCACATGGAGCAAGG - Intergenic
1072116237 10:92372914-92372936 CACCAGAGAAAGATGTAGGCCGG - Intergenic
1076846264 10:133070995-133071017 CACCAGGCACAGATGGCGCACGG + Intronic
1077047672 11:553564-553586 CTCCAGACACCGGTGGAGGCGGG + Intronic
1077334022 11:1995355-1995377 CACCCGGCCCAGATGGAGGGCGG + Intergenic
1077459813 11:2703361-2703383 AACCAGACACAAAAGGAGAATGG - Intronic
1078535565 11:12170732-12170754 CACCAAACCCAGATTGGGGATGG - Intronic
1081098610 11:38972073-38972095 CTCCAGATACAGATGGGAGATGG + Intergenic
1081515943 11:43829738-43829760 CACCAGAAACAGAATAAGGAAGG - Intronic
1082173325 11:49032350-49032372 CACCAGAACCAGATGCTGGAAGG + Exonic
1082953508 11:58844014-58844036 CACATGACACAGAAGGAAGAAGG + Intronic
1082969909 11:59009274-59009296 CACATGACACAGAAGGAAGAAGG + Intronic
1083291246 11:61691490-61691512 CTGCAGACACAGTTGGAGGCAGG - Intronic
1083494053 11:63034942-63034964 TACAAGACAGGGATGGAGGAGGG - Intergenic
1083628251 11:64082841-64082863 CACCAGACACCGAGGTAGGCAGG + Intronic
1084360359 11:68665040-68665062 CACCAGACACAGCTGGGGACTGG + Intergenic
1084564385 11:69920935-69920957 CAGCAGCCACAGGTGCAGGAGGG + Intergenic
1084603707 11:70160963-70160985 CACCAGAGACAGATGGATGAGGG - Intronic
1084927279 11:72523591-72523613 GACCAGACACATAGGGAGGATGG + Intergenic
1085837936 11:79976225-79976247 CTGCAGACACAGATGGAGATGGG + Intergenic
1086692435 11:89803697-89803719 CACCAGAACCAGATGCTGGAAGG - Exonic
1086696713 11:89855721-89855743 CACCAGAACCAGATGCTGGAAGG + Intergenic
1086709445 11:89988769-89988791 CACCAGAACCAGATGCTGGAAGG - Intergenic
1086713363 11:90035962-90035984 CACCAGAACCAGATGCTGGAAGG + Exonic
1086955778 11:92933440-92933462 TACCTCACACAGCTGGAGGAGGG + Intergenic
1088183664 11:107139968-107139990 CACCAGAGGCAAATTGAGGAGGG - Intergenic
1088344669 11:108809359-108809381 CAACCAACACACATGGAGGAAGG - Intronic
1088796067 11:113267783-113267805 CATCAGACCCAGCTGGAGGGCGG - Intronic
1090357789 11:126151510-126151532 AACCAGGCACAGATGCAGTAGGG + Intergenic
1090594462 11:128306446-128306468 GACCAGACACAAATAGATGAGGG + Intergenic
1090790438 11:130088945-130088967 CACCAGACAAAAATAGAGGATGG - Intronic
1202817005 11_KI270721v1_random:50537-50559 CACCCGGCCCAGATGGAGGGCGG + Intergenic
1093163441 12:15777083-15777105 TAACAGATATAGATGGAGGAAGG + Intronic
1096743709 12:53712375-53712397 CAGCAGACGGAGATGGAGGGAGG - Intronic
1096780561 12:53989492-53989514 CACCAGGCACAAAGGGAGGAGGG - Exonic
1097167481 12:57093496-57093518 CAGCAGACACTGATGGACGAGGG + Exonic
1100432135 12:94540492-94540514 CACCAGAAACACATGGGGAATGG - Intergenic
1100581161 12:95942362-95942384 CACCAGACACAGCTGAGGGGTGG + Intronic
1100891582 12:99131938-99131960 AACCAGAGACTGATGGAGAAAGG - Intronic
1101735720 12:107461363-107461385 ACACAGACACAGATGGAAGAAGG + Intronic
1101840470 12:108324237-108324259 GCCCAGACACAGATGTAGGGGGG + Intronic
1102229898 12:111255422-111255444 CAGCAGACACACCTGGAGGCAGG + Intronic
1103159446 12:118716184-118716206 CACAACACACAGTTGGAAGACGG + Intergenic
1103555888 12:121766236-121766258 CACCAGACACAAACCGAGGGTGG - Intronic
1104038737 12:125115811-125115833 GACTGCACACAGATGGAGGACGG + Intronic
1104382747 12:128322151-128322173 CAAGAGAGACAGATGGAGGCTGG - Intronic
1104466423 12:128994307-128994329 CACCTGAGACAGGAGGAGGAAGG + Intergenic
1104466435 12:128994345-128994367 CACCTGAGACAGGGGGAGGAAGG + Intergenic
1104509418 12:129363044-129363066 CAATAAACAAAGATGGAGGAAGG - Intronic
1107108609 13:36673118-36673140 CAGCAGAACCAGATGGAGTAGGG + Intergenic
1108019964 13:46117929-46117951 TACAAGAGACACATGGAGGACGG - Intergenic
1108779842 13:53816178-53816200 AAACAGACACAGAAGGAAGAAGG + Intergenic
1112250451 13:97774481-97774503 CAACAGAGGCAGATGGAAGAAGG - Intergenic
1112542963 13:100335665-100335687 CACCAGGCACAGTTGGACAAAGG + Intronic
1113448556 13:110389049-110389071 CATCAGACACAAAGGAAGGATGG - Intronic
1113822177 13:113222429-113222451 AACCAGACACGGATTGAGGCGGG + Intronic
1114261452 14:21039529-21039551 CAACAGAAAAAGATGGAGGAAGG - Intronic
1119507969 14:75189311-75189333 CCCCAGACCCTGAAGGAGGATGG - Intergenic
1120441719 14:84549431-84549453 CACCAGAAACTGAAAGAGGAAGG + Intergenic
1120863424 14:89275283-89275305 CAGCAGACACAGCTGGCTGAAGG + Intronic
1121283123 14:92713721-92713743 CAGCACCCACAGTTGGAGGACGG + Intronic
1121448555 14:93993660-93993682 CACCAGGCACAGCAGAAGGAAGG - Intergenic
1121854470 14:97254204-97254226 AAGGAGACACAGAAGGAGGAAGG - Intergenic
1122776669 14:104119909-104119931 CCCCTGACCCAGGTGGAGGATGG + Intergenic
1124364372 15:29061913-29061935 CACCACACGCTGATGGAGGGGGG - Intronic
1125431733 15:39602215-39602237 TAACACACACAGATGGAGGGAGG + Intronic
1125602871 15:40925253-40925275 CACCAGACTCACCTGGAGGGTGG + Intergenic
1127367171 15:58301933-58301955 CACCTGACAAATATGGTGGAAGG + Intronic
1127497019 15:59523081-59523103 CACAAGACAGAGATGCTGGAGGG - Exonic
1129117296 15:73371668-73371690 GGGCAGGCACAGATGGAGGAAGG + Intergenic
1129185689 15:73904854-73904876 CAAAACACACAGATGGAGGGAGG + Intergenic
1129291169 15:74568995-74569017 CAGCAGAGGCAGATGGAGGGTGG - Intronic
1130091534 15:80825057-80825079 CACCAGCTAAAGAGGGAGGAAGG + Intronic
1131559733 15:93429041-93429063 CAATAGACACGGATGGAGGTGGG + Intergenic
1132173793 15:99691188-99691210 CAACAGAGACAGAGGGAGGGGGG + Intronic
1132275895 15:100563709-100563731 CACCAGACATAGCTGGAGATAGG - Intronic
1132792268 16:1698196-1698218 CACAAGAGAGGGATGGAGGATGG + Intronic
1132976535 16:2713893-2713915 CAGCAGACCCAGAAGGAAGAGGG - Intronic
1133922189 16:10163286-10163308 CACCAGGCTCAGAAGGTGGAAGG + Intronic
1134694367 16:16212250-16212272 CAACAGACAAAAATGGAGAAGGG + Intronic
1134977466 16:18582380-18582402 CAACAGACAAAAATGGAGAAGGG - Intergenic
1136109155 16:28053796-28053818 AAACAGACAGAGATGGAGAAAGG - Intronic
1137273751 16:46919817-46919839 CACCAGACAGAGATGGGGAGAGG + Intronic
1137606923 16:49793224-49793246 CAGCAGGCACAGAGGAAGGAGGG + Intronic
1137884396 16:52086926-52086948 CACTAGAAGCAGAAGGAGGAGGG + Intergenic
1140191431 16:72820397-72820419 AACCTGACACAGAGGGAGCAAGG - Intronic
1140292512 16:73673876-73673898 CTCCAGATACAGATCCAGGAAGG + Intergenic
1140868674 16:79087073-79087095 TACCAGGCACTGATGGAGTAAGG + Intronic
1142223895 16:88868078-88868100 CCCCAGCCCAAGATGGAGGAAGG - Intergenic
1143464055 17:7123834-7123856 CACGGGGCACAGATGGAGGCCGG - Intergenic
1145046831 17:19625154-19625176 CACCAGATGAAGATAGAGGAGGG - Intergenic
1146717355 17:35097873-35097895 CACCAGACACAGTGGGAGCTGGG + Intronic
1146830849 17:36068227-36068249 CACCAGACACAGTAAGAAGAAGG + Intronic
1147254450 17:39173890-39173912 CACCAGACAGGGAGGGGGGAAGG + Exonic
1149559617 17:57599245-57599267 CCCGAGACACAGATGGGGAAAGG + Intronic
1150569054 17:66369753-66369775 CAGCCAACTCAGATGGAGGATGG - Intronic
1151151790 17:72094779-72094801 CACCAGAGAAAGATGCAGCAGGG - Intergenic
1151986904 17:77549397-77549419 GAACAGACACACATGGAGGTTGG - Intergenic
1152026828 17:77815378-77815400 CACCATAGACAGGTGGCGGAGGG + Intergenic
1152900462 17:82938093-82938115 GAGCAGACACAGCTGCAGGAGGG - Exonic
1153987859 18:10368942-10368964 GCCTAGACACAGCTGGAGGAGGG - Intergenic
1155335783 18:24764128-24764150 TACCAGGCCCACATGGAGGAGGG - Intergenic
1155679870 18:28475781-28475803 CCACTGACACTGATGGAGGATGG - Intergenic
1157202628 18:45672006-45672028 CCCCAGAGATAGATGGAGCACGG + Intronic
1157224194 18:45848150-45848172 ACCCAGACACAAATGGAAGATGG + Exonic
1157224455 18:45849906-45849928 CACCAGACATAGAGGGAGGGAGG - Exonic
1157511174 18:48275987-48276009 CTCAAGATACAGAGGGAGGAGGG + Intronic
1157587479 18:48813971-48813993 AGCCAGAGACAGATAGAGGAAGG + Intronic
1157649221 18:49311176-49311198 CACAAGGCACAGCTGGAGAAGGG + Intronic
1158497595 18:57970444-57970466 CACCAGATCCAGGTGGAGGAGGG + Intergenic
1158725502 18:59968224-59968246 CAAGAGACAGAGATGGAGGCAGG + Intergenic
1159001358 18:62978311-62978333 CACCACACTGGGATGGAGGAAGG - Exonic
1159794550 18:72826353-72826375 CTACAGACACACATGTAGGAGGG - Intronic
1160187777 18:76688806-76688828 CAGCAGACACACTAGGAGGATGG - Intergenic
1160707749 19:537279-537301 TGCCAGTCACAGATGGAGGCCGG + Intronic
1161479411 19:4503181-4503203 CCCCAGACCCAGGGGGAGGAAGG - Exonic
1162222080 19:9186248-9186270 CATCAGAGAAATATGGAGGAGGG - Exonic
1164648648 19:29876377-29876399 CAGGAGACACAGAAGGAGGCTGG - Intergenic
1164679115 19:30122157-30122179 CACTTCACACAGATGGAGGGAGG + Intergenic
1164890603 19:31820186-31820208 CACAAGACCCAGCTGGAAGAGGG - Intergenic
1166438191 19:42787493-42787515 AACCAGACACAGATGTGGTAGGG - Intronic
1166457140 19:42951287-42951309 AACCAGACACAGATGTGGTAAGG - Intronic
1166467088 19:43042146-43042168 AACCAGACACAGATGTGGTAGGG - Intronic
1166473222 19:43098232-43098254 AACCAGACACAGATGTGGTAGGG - Intronic
1166487170 19:43223334-43223356 AACCAGACACAGATGTTGTAGGG - Intronic
1166488194 19:43232576-43232598 CAAAAGGCACAGCTGGAGGATGG - Intronic
1166494011 19:43285221-43285243 AACCAGACACAGATGTGGTAGGG - Intergenic
1166494861 19:43293056-43293078 CAAAAGGCACAGCTGGAGGATGG - Intergenic
1167602307 19:50461461-50461483 CACAAGACACAGACGAAAGAAGG - Intronic
1167740276 19:51320439-51320461 CACCAGGCGGAGAGGGAGGAAGG - Intronic
1167926763 19:52827484-52827506 CACCAGACATGGATGGAGATGGG - Intronic
1167942055 19:52955776-52955798 CACCAGACATGGATGGAGATGGG - Intronic
1167944948 19:52980640-52980662 CACCAGACATGGATGGAGATGGG - Intergenic
1168710114 19:58494725-58494747 CAACAGAAACAAAGGGAGGAGGG - Intronic
926846963 2:17152037-17152059 CCACAGACAGTGATGGAGGAGGG + Intergenic
926906428 2:17809969-17809991 CAGCAGACACAGCAAGAGGATGG - Intergenic
927204186 2:20596758-20596780 CTTCAGACACAGCAGGAGGAAGG - Intronic
930769791 2:55119920-55119942 CACCAGCCTCAGATGCAGGAGGG + Intergenic
933244245 2:79957388-79957410 CACCAGCAGGAGATGGAGGAGGG + Intronic
936117406 2:109713078-109713100 CAAGAGACCCAGGTGGAGGAAGG - Intergenic
937126666 2:119478935-119478957 CATCAGACAAGGATGGGGGATGG + Intronic
937912203 2:127081167-127081189 CACCGAACCCAGAAGGAGGAAGG + Intronic
938581913 2:132654144-132654166 CACTAGCCAAAGATGGGGGAAGG + Intronic
938928635 2:136066747-136066769 CAAGATTCACAGATGGAGGATGG + Intergenic
939041710 2:137197270-137197292 CAGCAGAGAGAGATGGAGGAAGG + Intronic
940939335 2:159540013-159540035 CTCCAAACAGGGATGGAGGAAGG - Intronic
941398994 2:165007607-165007629 CACCAGTCATATATGGAGAATGG + Intergenic
941554056 2:166953454-166953476 TACCAGACACTCATGGTGGAAGG - Intronic
941886305 2:170531072-170531094 CAGCAGACACAGATCCAGAAAGG - Intronic
942399005 2:175581328-175581350 CACCAGACACAGATGGAGCCAGG + Intergenic
943513553 2:188856678-188856700 CACGAGAGAAAGATGGAGGCTGG + Intergenic
946138054 2:217664381-217664403 CACCACACCCAGCCGGAGGATGG - Intronic
946605068 2:221394963-221394985 CTCCACACACAGATGCAGGGAGG - Intergenic
947442812 2:230138009-230138031 CAGAAGACACAGAGGGAGGTAGG - Intergenic
947717835 2:232350777-232350799 TACCGGACACAGGTGGAGGTGGG + Intergenic
948045440 2:234940222-234940244 CATCAGAAACAGACGTAGGAGGG + Intergenic
948063838 2:235062020-235062042 AGGCAGACAGAGATGGAGGAGGG + Intergenic
948783522 2:240339421-240339443 CACCAGACACTGGAGGAGGCAGG + Intergenic
1169206915 20:3745733-3745755 TACCAGACAAAAAGGGAGGAGGG - Intronic
1170940957 20:20847820-20847842 CTCCTGACACAGATGGATGCAGG + Intergenic
1171079071 20:22159656-22159678 CACTAGAGAGAGAGGGAGGAGGG - Intergenic
1172086446 20:32387589-32387611 AACCAGACAAGGATGGAGTATGG - Intronic
1172250472 20:33475856-33475878 GGCCAGGCACAGAGGGAGGAGGG + Intergenic
1172355395 20:34276392-34276414 CACGAGAGACAGGTTGAGGAGGG + Intergenic
1172583326 20:36065197-36065219 CGCCAAGCACAGATGGAGGCTGG - Intergenic
1173016949 20:39234511-39234533 CACCAGGCTTTGATGGAGGATGG + Intergenic
1173541337 20:43854034-43854056 CAGCAGCCGCAGATGCAGGACGG - Intergenic
1174338827 20:49883400-49883422 CACAACACACAGATGAGGGATGG - Intronic
1175722792 20:61297517-61297539 CCCAAGACACAGATGGACCATGG - Intronic
1175787077 20:61718437-61718459 CACCCAACACAGAAGGAGGCAGG + Exonic
1176525297 21:7861829-7861851 CACGAGACAAAGATGTAGGCTGG - Intergenic
1176987503 21:15454943-15454965 CACAAGAGACAGATGTAGGCTGG - Intergenic
1178659317 21:34491842-34491864 CACGAGACAAAGATGTAGGCTGG - Intergenic
1180792821 22:18586009-18586031 CACCAGGCACAGGTGGGAGAAGG - Intergenic
1181228915 22:21409310-21409332 CACCAGGCACAGGTGGGAGAAGG + Intergenic
1181249736 22:21525555-21525577 CACCAGGCACAGGTGGGAGAAGG - Intergenic
1182876437 22:33695409-33695431 CACCTGATGCAGATGAAGGAAGG + Intronic
1183005710 22:34900002-34900024 CACTGGCCACAGATGGATGAGGG - Intergenic
1183264878 22:36818984-36819006 CAGCAGGGAGAGATGGAGGAAGG - Intronic
1185045435 22:48526225-48526247 CACCACACACAGACGGAGGAGGG - Intronic
950102573 3:10367045-10367067 CCCCAGGCACGGGTGGAGGAGGG - Intronic
950358958 3:12437001-12437023 CTCCACACACAGCGGGAGGAAGG - Intergenic
953798066 3:46000748-46000770 CACCGGACAGAGATGAAGGCTGG + Intergenic
953905334 3:46865747-46865769 TGCCACACACAGGTGGAGGAAGG - Intronic
954034089 3:47841173-47841195 CTCAAGGTACAGATGGAGGATGG + Exonic
954398096 3:50303552-50303574 CACCAGAGACTCCTGGAGGAAGG + Exonic
955458235 3:59149339-59149361 CAGGAGACCCAGAAGGAGGATGG - Intergenic
958271916 3:91510688-91510710 TACCATATTCAGATGGAGGAAGG + Intergenic
961434372 3:126906463-126906485 CACGAGGCACAGATGCAGGGAGG - Intronic
961595074 3:128009462-128009484 CACCAGACCCAGAGGCAGGGTGG - Intergenic
961751103 3:129095380-129095402 CCCCAGGGAAAGATGGAGGAAGG + Intronic
963552954 3:146747728-146747750 CACCAAACACAGATGGAAACTGG - Intergenic
965614392 3:170578147-170578169 CACCAGAAATAGATGGATGCTGG - Intronic
965751060 3:171975461-171975483 GAGCAGCCAGAGATGGAGGAGGG + Intergenic
967691508 3:192479352-192479374 CACCTGACTCAGATGGAGCCTGG - Intronic
967850378 3:194078004-194078026 CATCAGACATAGATTGGGGATGG - Intergenic
967985939 3:195095405-195095427 CCCCAGTCCCAGATGGTGGAAGG - Intronic
969445410 4:7242114-7242136 GACCAGCCACAGCAGGAGGAAGG - Intronic
969575228 4:8032718-8032740 CGCCAGGCAGAGAGGGAGGAGGG + Intronic
970795892 4:19912994-19913016 AACCAGACAGAGATGGGGCAGGG + Intergenic
971364269 4:25964988-25965010 CACCAGGCACAGAGGAAGGTGGG - Intergenic
971615573 4:28786567-28786589 CTGCAGACAGAGGTGGAGGAAGG + Intergenic
973726502 4:53782299-53782321 CAGCAGGCAAAGAGGGAGGATGG - Intronic
974459321 4:62166827-62166849 CACCAGAGAAAGATGTAGGCTGG - Intergenic
976278734 4:83305677-83305699 CACCAGATACAGTTGGAGGAAGG + Intronic
977292924 4:95182516-95182538 GAGGAGAGACAGATGGAGGATGG + Intronic
981844087 4:149146548-149146570 CCCCTGAGACAGATCGAGGAAGG + Intergenic
983267351 4:165521808-165521830 CACCAGAGAAAGATGTAGGCTGG + Intergenic
983647133 4:170003420-170003442 CTCAATACACAGATGAAGGAGGG + Intronic
984883853 4:184432731-184432753 ACACAGACACAGAGGGAGGATGG + Intronic
985631700 5:1017399-1017421 CCCCAGACAGAGCTGGAGCAGGG + Intronic
987324308 5:16798519-16798541 GTCCAGGCACTGATGGAGGATGG - Intronic
987374148 5:17218256-17218278 CAGCAGCCAAAGATGGAGGGTGG + Intronic
987608836 5:20175712-20175734 CACCAGAGAAAGATGTAGGCTGG + Intronic
988427375 5:31079146-31079168 AACCAGAAGCAGATGGAGGGAGG - Intergenic
989202065 5:38773549-38773571 CAGAAGGAACAGATGGAGGAAGG + Intergenic
989768534 5:45115229-45115251 CACCAGAAAAAGATGTAGGCTGG - Intergenic
990452768 5:55951504-55951526 CAGCATACACAGATGAAGGTGGG - Exonic
990516091 5:56532103-56532125 TGTCAGACAAAGATGGAGGAGGG - Intronic
991966697 5:72098798-72098820 CAACAGGCAGAGATGGAGAAAGG - Intergenic
993592197 5:89808050-89808072 CATGAGACATAGAGGGAGGAGGG - Intergenic
995891887 5:116963217-116963239 CAGCAGTCACAGCTGGAGAAGGG - Intergenic
996284466 5:121771924-121771946 CACCAGAAACTGAAGGAAGAGGG - Intergenic
997368575 5:133341557-133341579 CACCAGACAGAGAGGGGGAAGGG - Intronic
998038582 5:138936731-138936753 CACCAGGGGCAGATGGAGGATGG - Intergenic
998384305 5:141747636-141747658 CACCAGACACAGAGAAAGGAGGG + Intergenic
998506090 5:142674058-142674080 CACCAGGCACACATGAAGCAGGG - Intronic
1000297379 5:159923714-159923736 CATCAGAAACATCTGGAGGAGGG + Intronic
1000420381 5:161031920-161031942 TAGCAGAGACAGATGGTGGAGGG - Intergenic
1001325925 5:170723989-170724011 CAGCAGAGTCAGATGGTGGAGGG + Intronic
1002000931 5:176195946-176195968 AGCCACAGACAGATGGAGGAAGG + Intergenic
1002050292 5:176566700-176566722 TTCCAGTCACAGAAGGAGGAAGG + Intronic
1002253403 5:177943026-177943048 AGCCACAGACAGATGGAGGAAGG - Intergenic
1002377138 5:178796774-178796796 GACCTCACACAGATGCAGGAGGG - Intergenic
1002377149 5:178796811-178796833 GACCTCACACAGATGCAGGAGGG - Intergenic
1003013906 6:2452410-2452432 CAGCTGACACAGATGGTGGGAGG + Intergenic
1004040127 6:11967315-11967337 CACCAGAGAAAGATGTAGGCTGG + Intergenic
1004506392 6:16250209-16250231 CACCACCTCCAGATGGAGGAGGG + Intronic
1005300554 6:24466046-24466068 CAAAAGAAACAGATGGAGGCTGG + Intronic
1006338810 6:33434630-33434652 CACCAGGCCCAGGTGGAGCAGGG + Intronic
1007131937 6:39483364-39483386 CACAAGCAAGAGATGGAGGAAGG - Intronic
1007782870 6:44264290-44264312 CTCCAGACCCAGATGGAGTTTGG - Intronic
1008983195 6:57510445-57510467 TACCATACTCAGATGGAGGAAGG - Intronic
1009171252 6:60403316-60403338 TACCATACTCAGACGGAGGAAGG - Intergenic
1010106388 6:72174117-72174139 CTCAAATCACAGATGGAGGAGGG - Intronic
1010138881 6:72589110-72589132 CACCACACACAGGTTGAGGAAGG + Intergenic
1010648605 6:78424392-78424414 CACCAGTCACATGTGGAGCAAGG + Intergenic
1010697636 6:78996284-78996306 CACCAGACACAGATAGCAGTGGG - Intronic
1011312337 6:85993710-85993732 CACTAGACACAGATGCAAAAGGG - Intergenic
1013000637 6:106018887-106018909 CACCTCACACACAAGGAGGAGGG + Intergenic
1013180052 6:107709553-107709575 CACCAGCCACAGGCAGAGGAAGG - Intronic
1016086971 6:139926367-139926389 CACAAAACGCAGATGGAAGAGGG - Intergenic
1016938872 6:149468480-149468502 AAGCAGTCACATATGGAGGAAGG + Intronic
1018379231 6:163242563-163242585 CACCAGGCACAGAAGGGTGATGG + Intronic
1018578901 6:165290433-165290455 CATCAGACACAGCAGGAGGAAGG + Intronic
1018662978 6:166105432-166105454 GAGCAGACACAGGTGGAGGTAGG + Intergenic
1020005579 7:4782335-4782357 CTCCCGACACAGAGGGAGGGAGG - Intronic
1020066877 7:5195089-5195111 CACCAGGCACAGTTGAAGGTGGG + Intronic
1021846675 7:24769804-24769826 CACCAGACACAGATATGGCAGGG + Intergenic
1022942480 7:35253982-35254004 CCCCAGCCCCAGAGGGAGGAAGG - Exonic
1023165463 7:37338974-37338996 CTCCAGGCACTGATGGAGGGTGG + Intronic
1024617554 7:51128492-51128514 CACCAAACACAGAGCGGGGAGGG + Intronic
1026847129 7:73704554-73704576 TGCCAGGCACCGATGGAGGAGGG + Intronic
1027232351 7:76280367-76280389 CACGGCACACAGATGGGGGAGGG - Intronic
1027560349 7:79720580-79720602 CACCAGACCCTGAAGTAGGAGGG - Intergenic
1029197573 7:98816563-98816585 CACCAGGCACAGAGAGAGGTAGG + Intergenic
1029656594 7:101929292-101929314 CTCTAGACACATATGGAAGAAGG - Intronic
1031075493 7:117208474-117208496 TATCAGACCCAGAGGGAGGAAGG + Intronic
1034234626 7:149557100-149557122 CCCCAGAAACAGATGGGGAATGG + Intergenic
1034239406 7:149598332-149598354 CCCCAGAAACAGATGGGGAATGG + Intergenic
1034399485 7:150852653-150852675 AACAGGACACAGAGGGAGGAGGG + Intronic
1034909797 7:154986359-154986381 CACCAGGTACAGAAGCAGGAGGG - Intronic
1035251795 7:157602721-157602743 CAGCAGCCACTGATGGTGGAGGG - Intronic
1035279308 7:157767226-157767248 CATAAGCCACAGATGGATGATGG - Intronic
1035659047 8:1333198-1333220 CACATTACAGAGATGGAGGAAGG + Intergenic
1036436997 8:8743687-8743709 CATCAGACAGAGATGCAGGCTGG - Intergenic
1037121320 8:15290563-15290585 CACTAGCCACAGCTGGTGGAGGG - Intergenic
1038153271 8:24961662-24961684 CACCAGACTCAGAGGTAAGAGGG + Intergenic
1039176273 8:34810370-34810392 CAGCAGAAAGAGATGGAGGCTGG + Intergenic
1039246610 8:35615392-35615414 AACCACAAACAGATGGATGAGGG - Intronic
1042613137 8:70619576-70619598 CAGCAATCACAGATAGAGGAAGG + Intronic
1043875794 8:85484603-85484625 CAGCAGACACAGATGGAGCCAGG - Intergenic
1044770570 8:95626782-95626804 CATCACACAAAGATGGAGAAAGG + Intergenic
1045466239 8:102472692-102472714 CACCAGAGCCAAATGGAAGAAGG + Intergenic
1046778135 8:118185738-118185760 CACCAGCCATGGATGGAGAAGGG - Intergenic
1047533736 8:125700261-125700283 TTCCAAACACAGATGGAGGAAGG + Intergenic
1048037157 8:130688242-130688264 CCTGAGACATAGATGGAGGAAGG + Intergenic
1048188344 8:132264706-132264728 CACTAGACAGAGATAGAGCACGG - Intronic
1048296445 8:133218064-133218086 CACCAGACACCAGTGAAGGAGGG - Intronic
1048808703 8:138265131-138265153 CACCAGAGAAAGAAAGAGGAAGG - Intronic
1049062792 8:140289014-140289036 GGACACACACAGATGGAGGAAGG + Intronic
1050534247 9:6618098-6618120 AATCAGACATAGATGGAGTATGG - Intronic
1053471425 9:38348324-38348346 ACCCAGACAGAGAAGGAGGAGGG - Intergenic
1055241130 9:74187840-74187862 CACAAGACAAAGAAGGGGGATGG + Intergenic
1055988016 9:82073086-82073108 CAACAGACACCAATGGTGGAGGG + Intergenic
1056066184 9:82937378-82937400 CACCAGACAGAGGTTGAGTATGG + Intergenic
1059328668 9:113520612-113520634 CTCCAGACCCAGAGGGAGGCTGG - Intronic
1059456692 9:114404181-114404203 CCCCAGGCAAAGATGGGGGAAGG + Intronic
1059523024 9:114961741-114961763 CACCAGGCACAGTTGGAAGAAGG + Intergenic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1060223453 9:121776306-121776328 TACCAGGCACGGCTGGAGGAGGG + Exonic
1060374336 9:123105229-123105251 CACCAGGCAGAGATGGAAGAGGG + Intergenic
1062076693 9:134593580-134593602 CTCCAGGCGCAGGTGGAGGATGG - Intergenic
1062301853 9:135878065-135878087 CACCAGGGAAAGGTGGAGGAAGG + Intronic
1062585916 9:137249975-137249997 CTCCAGACACAGATAGGGGCAGG - Intergenic
1062588778 9:137263646-137263668 CTCCAGACCCTGATGGGGGAAGG + Intronic
1185448561 X:271233-271255 CCCAGGACACAGAGGGAGGAAGG + Intergenic
1186149746 X:6661661-6661683 CATCAGAAAGAGATGGAAGAAGG - Intergenic
1186173824 X:6904552-6904574 CACCAGGCTCAGAAGGATGAGGG + Intergenic
1187358222 X:18598983-18599005 TGCCAAACACAGATGGTGGATGG + Intronic
1187602906 X:20851650-20851672 AAACAGACACACAGGGAGGAAGG + Intergenic
1187608352 X:20911951-20911973 AAGCAGACAGAGATGGAGGTGGG - Intergenic
1188368836 X:29343900-29343922 CACCACACACAAATGTAGGTAGG + Intronic
1189302109 X:39959662-39959684 CAGCAGGGAAAGATGGAGGAGGG + Intergenic
1190172337 X:48121622-48121644 CACCAGCCCCAGGTGGAGGCAGG + Intergenic
1190177979 X:48167271-48167293 CACCAGCCCCAGGTGGAGGCAGG + Intergenic
1190183945 X:48218915-48218937 CACCAGCCCCAGGTGGAGGCAGG + Intronic
1190189878 X:48268368-48268390 CACCAGCCCCAGGTGGAGGCAGG + Intronic
1190193186 X:48294376-48294398 CACCAGCCCCAGATGGAGGCAGG - Intergenic
1190197102 X:48329057-48329079 CACCAGCCCCAGGTGGAGGCAGG + Intergenic
1190301708 X:49060839-49060861 CACAATACACAGATGGGGAAGGG + Intronic
1190658623 X:52634868-52634890 CACCAGCCCCAGGTGGAGGCAGG + Intergenic
1190659693 X:52642988-52643010 CACCAGCCCCAGGTGGAGGCAGG - Intergenic
1190665922 X:52695824-52695846 CACCAGCCCCAGGTGGAGGCAGG - Intronic
1190673496 X:52762586-52762608 CACCAGCCCCAGGTGGAGGCAGG + Intronic
1190677041 X:52791357-52791379 CACCAGCCCCAGGTGGAGGCAGG + Intergenic
1190832037 X:54067466-54067488 CACCAGAAACAAAGGGAGAAAGG + Intergenic
1191670577 X:63745018-63745040 CACAATTCACAGAGGGAGGAGGG + Intronic
1191941636 X:66487296-66487318 CACGAGAGAAAGATGTAGGATGG + Intergenic
1192257910 X:69480722-69480744 CACCACACACACATTGATGAGGG + Intergenic
1192922848 X:75725141-75725163 CACCAGAGAAAGATGTAGGTTGG + Intergenic
1193568524 X:83111303-83111325 CACAAGAGAAAGATGGAGGCCGG + Intergenic
1195430731 X:104786316-104786338 GAACAGATACAGATTGAGGAAGG - Intronic
1196673822 X:118398434-118398456 CAACAGATACTGATGGTGGAAGG + Exonic
1198596731 X:138244025-138244047 AAGCTGACACAGCTGGAGGAAGG - Intergenic
1198891467 X:141402252-141402274 CACCAGAGAAAGATGTAGGCTGG + Intergenic
1199024691 X:142922302-142922324 CACCAGAGAAAGATGCAGGCTGG - Intergenic
1199849976 X:151718768-151718790 CACCACATTCAGATGGATGAGGG + Intronic
1201765409 Y:17569837-17569859 ATCCAGACAAAGACGGAGGAAGG + Intergenic
1201836143 Y:18336152-18336174 ATCCAGACAAAGACGGAGGAAGG - Intergenic