ID: 1063953863

View in Genome Browser
Species Human (GRCh38)
Location 10:11247916-11247938
Sequence CTGGGTCTTCAGAACAGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 231}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063953863 Original CRISPR CTGGGTCTTCAGAACAGAGG AGG (reversed) Intronic
900715035 1:4138720-4138742 CTGGGTCTTTAGGTAAGAGGTGG + Intergenic
900894108 1:5470867-5470889 CTGGTTCTACAGGACACAGGTGG + Intergenic
901316749 1:8314968-8314990 CTGGGGGATCAGAACAGTGGGGG - Intergenic
901712248 1:11124920-11124942 CAGGCTTCTCAGAACAGAGGAGG - Intronic
901967866 1:12883022-12883044 CTGGGTCGTGAGAAGTGAGGAGG - Intronic
901985746 1:13074044-13074066 CTGGGTCATGAGAAGTGAGGAGG + Intronic
901996063 1:13152723-13152745 CTGGGTCATGAGAAGTGAGGAGG - Intergenic
903381608 1:22900836-22900858 CTGCGTGGTCAGGACAGAGGAGG + Intronic
905651613 1:39660725-39660747 CAGGGACTTCAGAGAAGAGGTGG + Intronic
905858291 1:41329626-41329648 CTGGGTCATCAGAAGAGTGGGGG - Intergenic
906001845 1:42433179-42433201 CAGGATCTTCAGAACAAAGATGG + Exonic
906963129 1:50431488-50431510 TTGGGTCTTCAGGAGAGAGCTGG + Intergenic
907118355 1:51989346-51989368 CTTGGACTACAGAACAGAGTTGG + Intronic
907549051 1:55288564-55288586 CTGGCACATCAGAGCAGAGGCGG + Intergenic
908340388 1:63172469-63172491 CTGGATGATCAAAACAGAGGGGG - Intergenic
909973929 1:82023259-82023281 CTGGGTCTTCAGAAATCAGAAGG - Intergenic
911271421 1:95806297-95806319 CAGGGTCTGCAGAGCAGAAGAGG - Intergenic
911498679 1:98660814-98660836 ATGGGCCTACAGAAAAGAGGTGG + Intergenic
911535781 1:99098591-99098613 CAGGGGCCACAGAACAGAGGGGG - Intergenic
913256868 1:116961840-116961862 CTGGGGCTTGGGGACAGAGGAGG - Intronic
913560792 1:120017371-120017393 CAGGGTTATAAGAACAGAGGGGG - Intronic
914281375 1:146176784-146176806 CAGGGTTATAAGAACAGAGGGGG - Intronic
914542420 1:148627719-148627741 CAGGGTTATAAGAACAGAGGGGG - Intronic
914624213 1:149443524-149443546 CAGGGTTATAAGAACAGAGGGGG + Intergenic
919019184 1:192081908-192081930 CTCTGTCTACAGAACTGAGGAGG - Intergenic
919690001 1:200520768-200520790 CTGGTTCTTCTGGACAGATGTGG - Intergenic
920940084 1:210473910-210473932 CTCAGTCCTCAGAACTGAGGTGG - Intronic
921449775 1:215291508-215291530 CTGGGTCTGTAAAACAGAGAAGG - Intergenic
922180294 1:223228028-223228050 CTGCCTCTTGAGAACAGAGGTGG + Intronic
922535048 1:226373429-226373451 GGGGGCCTTCAGAGCAGAGGTGG - Intronic
923282445 1:232457069-232457091 ATGGGACTTCAAAACACAGGTGG + Intronic
924074521 1:240319527-240319549 GTGAGTCTTCACAACAGATGTGG + Intronic
1063176182 10:3552772-3552794 CTGGGTCTTCAGAAGTGAAAGGG - Intergenic
1063316879 10:5015467-5015489 CTGTGTCTACAGAACACAGAGGG - Intronic
1063355514 10:5395182-5395204 CTGGGTGCTCAGAACTGGGGAGG - Intronic
1063953863 10:11247916-11247938 CTGGGTCTTCAGAACAGAGGAGG - Intronic
1067274863 10:44824978-44825000 ATGAGTCCTAAGAACAGAGGTGG - Intergenic
1068663535 10:59648209-59648231 CAGGGTCATCAGAGCAGAGAGGG - Intergenic
1070351118 10:75593001-75593023 ATGGGTGTTCAGCAGAGAGGAGG - Intronic
1072741976 10:97915074-97915096 CTGAGTGTTCAGGACAGCGGGGG - Intronic
1074234053 10:111566983-111567005 CTGGGTATTCAAAACAGAAGCGG + Intergenic
1075705149 10:124496149-124496171 CTGCGTCTTCAGAGCAGCGCAGG + Intronic
1076116456 10:127905178-127905200 CTGGGCTGTCAGAGCAGAGGAGG - Intergenic
1076587592 10:131559965-131559987 CTGACTCCTCAGAAGAGAGGAGG + Intergenic
1078660608 11:13282593-13282615 CTGGGTCCTAAAAGCAGAGGAGG - Intronic
1079010032 11:16820530-16820552 CTGAATCCTCAAAACAGAGGTGG + Intronic
1079500496 11:21096485-21096507 CTGGGGCTTCAGAAGAGAAAGGG - Intronic
1081120041 11:39255319-39255341 CTGTGTCTACATATCAGAGGAGG - Intergenic
1081161565 11:39755871-39755893 CTGTGGCTGCAGAACAGCGGTGG - Intergenic
1081814710 11:45932112-45932134 CTTGGTGCTTAGAACAGAGGAGG - Intronic
1082073855 11:47961441-47961463 CTGGCTCTTAAGGACAGTGGTGG - Intergenic
1082740595 11:56906733-56906755 CTGACTCCTCAGAACAGAGGAGG - Intergenic
1084085534 11:66853378-66853400 GTTGGTCTGCAGGACAGAGGCGG + Exonic
1085284240 11:75349847-75349869 CTGGGCCTCCAGCACAGAGCAGG + Intronic
1088472520 11:110201608-110201630 CTGGATATTCACAACACAGGAGG + Intronic
1089135663 11:116247090-116247112 CTGAGTCTTCAGATCCCAGGTGG - Intergenic
1090183815 11:124722994-124723016 AGGGATCTTCAGAACAGGGGAGG - Intergenic
1090660478 11:128878589-128878611 GTGGGTCTTCAGAGAGGAGGCGG - Intergenic
1091641633 12:2241556-2241578 CTGGGTCTTCCGAAGACAGATGG + Intronic
1091766136 12:3120945-3120967 TTGGGCCTTCAGAACTCAGGTGG + Intronic
1092121940 12:6050513-6050535 AGGGGTCTTCAGAAGTGAGGGGG - Intronic
1096526483 12:52213078-52213100 CTGGGTCTGGAGAAGGGAGGAGG + Intergenic
1097029111 12:56079330-56079352 CTGGGTCCCCAGAAGAGCGGCGG + Intergenic
1099357488 12:81657205-81657227 CTGGGTCTCCAGAAGATTGGCGG - Intronic
1101452416 12:104791507-104791529 CTCGGTGTTAAGAACAGAAGTGG + Intergenic
1103419857 12:120771687-120771709 CTGTGTTTGCAGAACAGTGGAGG - Intronic
1106004467 13:25756020-25756042 CAAGGTCTTCAGGACAGAGGTGG - Intronic
1106013428 13:25846225-25846247 CTGTGTCCCCAGAACACAGGAGG - Intronic
1107014384 13:35696690-35696712 CTGTCTCCTCTGAACAGAGGTGG + Intergenic
1109415273 13:62031379-62031401 ATGGGTCTTCAGAAATGAGGAGG - Intergenic
1110255917 13:73433935-73433957 CTCCTTCTCCAGAACAGAGGAGG + Intergenic
1110685707 13:78371483-78371505 CTGGCTATTCAGAATTGAGGAGG - Intergenic
1117431265 14:55664666-55664688 CTCTGTCTTCAGAACAATGGAGG + Intronic
1119612410 14:76074789-76074811 CTGGATCTTCAGCAAAGAAGGGG - Intronic
1119664955 14:76478731-76478753 CTGGGTATAGTGAACAGAGGAGG + Intronic
1121224329 14:92310145-92310167 CTGGCTCTTGGCAACAGAGGTGG + Intergenic
1202893824 14_KI270722v1_random:184078-184100 CTGGTACTTCAAAGCAGAGGAGG + Intergenic
1123429371 15:20201938-20201960 CTGGGTCAGCAGAGCAGAGGAGG - Intergenic
1126248710 15:46541533-46541555 CGGTGGCTTCAGAACAGCGGTGG + Intergenic
1126481563 15:49128029-49128051 CTGGATCATCAGAAGAGGGGTGG - Exonic
1127378530 15:58407446-58407468 ATGGGTCTTCTGAATGGAGGAGG - Intronic
1129068834 15:72934149-72934171 CTGGGTTGTCAGATCAGATGAGG + Intergenic
1129651853 15:77496697-77496719 CAAAGTCTTCAGACCAGAGGTGG + Intergenic
1130640070 15:85664504-85664526 CTGGGTCTCAAAAACAAAGGAGG - Intronic
1132457470 16:32149-32171 CTGGGTCCTCAGATCACAGAGGG + Intergenic
1134042843 16:11081377-11081399 CTGGGTGCCCAGGACAGAGGAGG - Intronic
1136381641 16:29898841-29898863 CTGGGTCTTCCGAGCACATGGGG - Intronic
1136710904 16:32235438-32235460 CTTGTTCTTCATCACAGAGGTGG - Intergenic
1136757006 16:32693973-32693995 CTTGTTCTTCATCACAGAGGTGG + Intergenic
1136811103 16:33176402-33176424 CTTGTTCTTCATCACAGAGGTGG - Intergenic
1136817579 16:33286482-33286504 CTTGTTCTTCATCACAGAGGTGG - Intronic
1136824143 16:33343011-33343033 CTTGTTCTTCATCACAGAGGTGG - Intergenic
1136995816 16:35187556-35187578 CTGGGCCCTTAGAACAGATGAGG - Intergenic
1137253630 16:46757944-46757966 CCGGGTCTGCAGCAGAGAGGTGG + Intronic
1138057753 16:53853477-53853499 CTGGAGATTCAGAAGAGAGGAGG - Intronic
1138392893 16:56683062-56683084 CTGGTCCTTCAGCACAGAGGAGG + Intronic
1138440269 16:57030114-57030136 ATGGGCCTTGAGAAAAGAGGAGG + Intronic
1139108790 16:63863483-63863505 CTTGGTTTTTAGAACAGAAGAGG + Intergenic
1140200559 16:72891331-72891353 CTGGGGTATCAGAACAGAAGAGG + Intronic
1140785302 16:78335757-78335779 CTGGCTCTGCAGAACTGAGGTGG + Intronic
1141289165 16:82701856-82701878 CTGTGTCTTCAGAAGAGGGGAGG - Intronic
1203059155 16_KI270728v1_random:954324-954346 CTTGTTCTTCATCACAGAGGTGG + Intergenic
1143842091 17:9740684-9740706 CTGGGACTTCAAAAGAGGGGAGG + Intergenic
1146964183 17:37010851-37010873 GTGGGCCTGCAGCACAGAGGCGG + Intronic
1147338673 17:39741292-39741314 CTGGGGCTTCAGGAAAGAGTTGG + Intronic
1148807155 17:50269699-50269721 CTGGGTCTACTTCACAGAGGAGG - Intergenic
1149983075 17:61326781-61326803 ATGGGTCTTCAGCACAGAAGAGG + Intronic
1153501643 18:5755789-5755811 CTGGCTCTTCAGAGTCGAGGAGG + Intergenic
1160414419 18:78698199-78698221 CCGGGTCGTCAGAACAGACAGGG - Intergenic
1162194113 19:8970843-8970865 CTGGGACTCCAAAATAGAGGAGG + Intronic
1162396919 19:10422668-10422690 GGGGGTGATCAGAACAGAGGTGG - Intronic
1163029956 19:14537437-14537459 CTGGTTCCTGAGAACAGAGGAGG + Intronic
1163526529 19:17824826-17824848 CTGAGGCCTCAGTACAGAGGGGG - Exonic
1164236904 19:23345562-23345584 CTGGGTGGTGAGAACAGAGGAGG - Intronic
1165848723 19:38836334-38836356 CTGTGTCTTCAGGACAGAGAGGG + Intronic
1166373400 19:42314471-42314493 ATGGGTCATCAAAATAGAGGAGG - Exonic
1166914569 19:46186257-46186279 CTGGGTCTTCAGGTCGGCGGGGG - Intergenic
1167526705 19:49988785-49988807 CTGGGTTTTCAGAAGTGAGCTGG - Intronic
1167693288 19:51000373-51000395 CTGGGGCTTAAGGAAAGAGGGGG - Intronic
927455103 2:23242315-23242337 CTGGGTCACTACAACAGAGGAGG - Intergenic
931683456 2:64771614-64771636 CAGGGTCTTCAGCACAGAAAAGG - Intergenic
931830727 2:66048448-66048470 CTGGGTCTTCAGAAAGAAGGAGG - Intergenic
933620065 2:84528508-84528530 CAAGGTGGTCAGAACAGAGGGGG + Intronic
933623747 2:84575079-84575101 CTGGGGGTTCCAAACAGAGGAGG - Intronic
934041672 2:88132014-88132036 CTGGGTGTTTTGAACATAGGAGG + Intergenic
935315100 2:101825224-101825246 CTAGGTCTTTAGAAAAGAGAGGG + Intronic
937155272 2:119714616-119714638 CTGGGTCTGAGGAACAGAGTTGG - Intergenic
940839387 2:158561631-158561653 CTGGGGCCACAGAGCAGAGGTGG - Intronic
944352587 2:198746307-198746329 CTGGGCCTTTAAAAGAGAGGTGG - Intergenic
945281747 2:208041949-208041971 CAGGGTCTTGAGAAGACAGGAGG - Intergenic
946305236 2:218853153-218853175 CCGGGTCTTCTGAACTCAGGTGG - Intergenic
946987771 2:225292190-225292212 CTTGGACTGCAGAACAGATGTGG - Intergenic
947526384 2:230878999-230879021 ATGGAATTTCAGAACAGAGGAGG - Exonic
948536695 2:238652221-238652243 CTGGGTCTACAGCACAGGGCCGG + Intergenic
949078713 2:242079399-242079421 CTGGATCTTCAGAACCAAGTTGG - Intergenic
1171354725 20:24534930-24534952 CCAGCTCTTCAGAGCAGAGGTGG - Intronic
1171405788 20:24911641-24911663 ATGGGTCATCAGAGCAGAAGGGG + Intergenic
1172805829 20:37610944-37610966 CAGGGTCTTTTAAACAGAGGAGG - Intergenic
1173070495 20:39759845-39759867 CTAGCTTTTCAGAACAGAAGTGG - Intergenic
1173967368 20:47122916-47122938 CTGGCTCTTGAGACCAGGGGTGG - Intronic
1174040838 20:47698161-47698183 CGGGGTTTCCAGAACAGAAGTGG + Intronic
1174933759 20:54844954-54844976 CTGGGTTTTCAGAACAATTGTGG - Intergenic
1175711069 20:61221554-61221576 CTGGGTTTAAGGAACAGAGGAGG - Intergenic
1175905143 20:62375859-62375881 CTGGCTCTCCTGCACAGAGGTGG - Intergenic
1176338661 21:5622482-5622504 CTGGGTCATCAGGTCTGAGGTGG - Intergenic
1176340069 21:5685555-5685577 CTGGGTCATCAGGTCTGAGGTGG - Intergenic
1176472323 21:7117708-7117730 CTGGGTCATCAGGTCTGAGGTGG - Intergenic
1176495884 21:7499486-7499508 CTGGGTCATCAGGTCTGAGGTGG - Intergenic
1176504758 21:7638901-7638923 CTGGGTCATCAGGTCTGAGGTGG + Intergenic
1177538397 21:22459716-22459738 GTCTATCTTCAGAACAGAGGTGG + Intergenic
1178583353 21:33853985-33854007 CTGGGGATTCAGGACAGAAGAGG - Intronic
1180092667 21:45541055-45541077 CTTGGTCATCTGAACAGGGGTGG - Intronic
1180755462 22:18157876-18157898 CTGCGGCTTCAGAGCGGAGGGGG - Intronic
1181103662 22:20558447-20558469 CTGGGGCTGCAGTACAGAGTTGG + Intronic
1182035369 22:27194349-27194371 GTGAGTATTCAGAACAGTGGAGG + Intergenic
1182747856 22:32619384-32619406 CTGGTATTTCAGAACAGGGGTGG - Intronic
1182900092 22:33890756-33890778 CAGGTTGTTCAGGACAGAGGAGG + Intronic
1183094544 22:35544269-35544291 CTGGGCCTTCAGCAGAGATGGGG - Intronic
951745838 3:25976417-25976439 CTGGGTTTTAAAAACAAAGGTGG - Intergenic
952491894 3:33881536-33881558 CTGTGTCTTCAGAACCGGTGTGG + Intergenic
954640214 3:52093348-52093370 CTTGGCCCTCAGAGCAGAGGTGG - Intronic
954796946 3:53166318-53166340 CTGGCTCTTCAGAACTTAGGTGG - Intronic
956630951 3:71316110-71316132 CTGGATCTGCAGAAGAGAAGGGG - Intronic
956902874 3:73735262-73735284 CTGGGTCTTTGAGACAGAGGGGG + Intergenic
959616860 3:108358388-108358410 TTGGGGCTTCAGAAATGAGGAGG + Intronic
961596478 3:128022063-128022085 CTAGGTTTTTAGGACAGAGGAGG - Intergenic
961645973 3:128392956-128392978 CAGGGTCTTCAGAAGACAGGGGG + Intronic
962379435 3:134885691-134885713 CTGGGTCAACAGAACCCAGGGGG + Intronic
963576050 3:147061572-147061594 CGGGGCTTTCAGATCAGAGGTGG - Intergenic
964145254 3:153453085-153453107 CTGGGTCTCCAGAATACAGAAGG + Intergenic
967412081 3:189176986-189177008 CTGTGTGTTGAGAACAGATGAGG + Intronic
968917535 4:3503129-3503151 CTGGGCCTGCTGAACCGAGGGGG - Intergenic
976709740 4:88056511-88056533 CTCAGTCTTCAGAACAGTGTTGG - Intronic
976778771 4:88735549-88735571 CTAGGCCTTCAGAACTGAGCTGG + Intronic
978347448 4:107787161-107787183 CTGGGTCTGCAGGTCAGAAGAGG - Intergenic
979524696 4:121704757-121704779 CTGGGTCTTCAGCTCACAGATGG + Intergenic
979664199 4:123293064-123293086 CTGGATATTCAGATCAGACGAGG + Intronic
981527404 4:145720322-145720344 TCTGGACTTCAGAACAGAGGAGG - Intronic
984310705 4:178054075-178054097 CTGGGACTTTACAATAGAGGAGG + Intergenic
984869512 4:184313959-184313981 CCCGGTCTGCAGGACAGAGGAGG + Intergenic
986405734 5:7423254-7423276 CTGGCTCTTTGGAGCAGAGGAGG + Intronic
987049199 5:14135422-14135444 CTGTGGCTTCAGAGCAGAGTTGG - Intergenic
988513087 5:31882220-31882242 CTGTGTCCTCTTAACAGAGGAGG + Intronic
988962754 5:36386074-36386096 CTGTTTCTTCAGGCCAGAGGAGG + Intergenic
991046905 5:62232374-62232396 CTGGGTCAGCAGAGCAGAGGAGG - Intergenic
992395465 5:76365463-76365485 ATGGATTTTCAGAACAGAGTAGG - Intergenic
999691999 5:154156127-154156149 CTGGAACTTCACAAAAGAGGAGG + Intronic
1000023579 5:157339572-157339594 TTGAGTCTTCAGACTAGAGGAGG + Intronic
1001235239 5:170023724-170023746 CTGGCATTTCATAACAGAGGAGG + Intronic
1002384932 5:178859787-178859809 CTGGTTCTTCGGAAGAGAAGGGG - Intergenic
1002927819 6:1614913-1614935 GTGCGTCTTCACAACAAAGGAGG - Intergenic
1003426317 6:6000313-6000335 TTGGGTTTTCAGAAGAAAGGGGG - Intronic
1004685292 6:17937463-17937485 CTGTGTCTTCAGGACTGTGGAGG - Intronic
1005927314 6:30454039-30454061 CCGGCTCTGCGGAACAGAGGAGG + Intergenic
1005930843 6:30482419-30482441 CCGGCTCTGCGGAACAGAGGAGG + Intergenic
1007262257 6:40571967-40571989 CAGGGTCTCCAAAACAGGGGGGG + Intronic
1010500553 6:76594157-76594179 CTTGGTCTACAGCCCAGAGGTGG - Intergenic
1011334523 6:86245602-86245624 CTGGGACTTCAAAAGAGGGGAGG - Intergenic
1013194236 6:107831550-107831572 CTGGGACTGGAGAATAGAGGAGG + Intergenic
1013429698 6:110044364-110044386 CTGGGTCTGCAGAAGTGAAGTGG - Intergenic
1013670778 6:112400027-112400049 CTAGCTCCTCAGAACACAGGAGG - Intergenic
1014312489 6:119821671-119821693 CTGGGTCTTGAAGAAAGAGGAGG + Intergenic
1015633288 6:135252357-135252379 CCGGGTCTTGAGAACTGACGGGG - Intergenic
1015833578 6:137395522-137395544 ATGAGTCTTTAGAACTGAGGTGG + Intergenic
1016926864 6:149359827-149359849 CTGGTTTTTCATAACAGAAGAGG + Intronic
1017331783 6:153207957-153207979 CATGGTCTTCAAAACAGATGAGG - Intergenic
1019536543 7:1532282-1532304 CGGGGTCTGGAGAACATAGGTGG + Intronic
1019738287 7:2661019-2661041 CTTGGACTTAGGAACAGAGGCGG - Intronic
1019943380 7:4308469-4308491 CTGGATCTCCAGAACGGAGAGGG - Intergenic
1020994556 7:15246635-15246657 TTGGGTCTTCAGTACAGGAGAGG - Intronic
1022648392 7:32252626-32252648 CTGTGGCTGCAGCACAGAGGAGG + Intronic
1025639041 7:63350064-63350086 CTGGGACTTCAGATCACAGCGGG - Intergenic
1025643658 7:63398028-63398050 CTGGGACTTCAGATCACAGCGGG + Intergenic
1027172672 7:75883809-75883831 CAGGGTCTTCAGCCGAGAGGAGG + Exonic
1027367267 7:77471237-77471259 CTGGGACTACAGTAGAGAGGAGG + Intergenic
1028444794 7:90909404-90909426 CTGGGTCTTCCTAATAAAGGTGG - Intronic
1029442090 7:100592577-100592599 CTGGGTCCTCAAAAGAGAGGTGG - Intronic
1029503206 7:100946593-100946615 CTGTGTCTCCAGAACAGTGATGG + Intergenic
1032996959 7:137457535-137457557 CTGAGTTTTCAGAACACAGGAGG + Intronic
1033492967 7:141862517-141862539 CTGGCTGTTCAGAGCAGAGAGGG + Intergenic
1033495121 7:141886472-141886494 CTGGCTGTTCAGAGCAGAGTGGG + Intergenic
1033544144 7:142384769-142384791 CTGGATCTTCAGAGTAGAGACGG - Intergenic
1033870202 7:145744868-145744890 CTGTGTCTTTTGAGCAGAGGTGG - Intergenic
1034422778 7:150998094-150998116 CTTGGTATCCAGTACAGAGGAGG - Intronic
1034424896 7:151009294-151009316 CAGGGTGTTCAGGACAGGGGTGG - Intronic
1035249299 7:157586645-157586667 CTGAGTCTCCAGGACAGACGTGG - Intronic
1035536979 8:399420-399442 CTGGATCTTCAGAACCAAGTTGG - Intergenic
1036189358 8:6656232-6656254 CTGTGTCTTCACCACAGTGGTGG - Intergenic
1036289212 8:7472623-7472645 CTGGGTCTGTAGAGCAGAGGAGG - Intronic
1036332269 8:7838904-7838926 CTGGGTCTGTAGAGCAGAGGAGG + Intronic
1037982414 8:23263592-23263614 CTAGGCCATCAGAAAAGAGGAGG + Intergenic
1041971000 8:63742627-63742649 CTGTGTACTCAGAAGAGAGGAGG + Intergenic
1045807931 8:106187155-106187177 ATGGGTGATCAGAACAGTGGAGG + Intergenic
1046129228 8:109946507-109946529 CTGGGTCTTCAGGCCAGTGATGG - Intergenic
1049153795 8:141055042-141055064 CAGGGTAATCAGAACAGAGGGGG - Intergenic
1049565891 8:143338810-143338832 CTGGGCCTGCAGACCAGAAGGGG + Intronic
1052029181 9:23609258-23609280 TTAGGTCCTCAGAACAGAGATGG - Intergenic
1055455912 9:76471379-76471401 CTAGGTCTTCAGTATAGGGGTGG - Intronic
1055900104 9:81224409-81224431 CAGGGTCTTCAAACCAGAGTTGG + Intergenic
1057834015 9:98429712-98429734 CAGGGACTTCAGAACAAAGCAGG + Intronic
1058162238 9:101582157-101582179 CTGTTTCTCCAGAATAGAGGTGG - Intronic
1061945375 9:133905723-133905745 CTGGGGCTGCAGCACAGATGAGG + Intronic
1062209754 9:135357109-135357131 CTGGGTCATCAGGCTAGAGGGGG + Intergenic
1062543906 9:137053431-137053453 CTGGGTATTCAGCCCAGATGGGG - Intronic
1062546668 9:137066657-137066679 CTGGGTGTGCAGAAGAGAGCTGG - Intronic
1203422998 Un_GL000195v1:12438-12460 CTGGGTCATCAGGTCTGAGGTGG + Intergenic
1185710798 X:2301979-2302001 CCGGGTCCCCAGAACAGAGGTGG + Intronic
1186484090 X:9919640-9919662 CTGGATCTTCAGAACAGGAATGG + Intronic
1187486719 X:19711168-19711190 CTGGGTCTTGAGATCACAGAAGG + Intronic
1189021763 X:37349164-37349186 CTGGGTCTTCCCAGCAGAAGCGG + Intergenic
1192192459 X:68999764-68999786 CTGGTTTTTCAGAACTGAGATGG - Intergenic
1192555358 X:72084742-72084764 CTGGGGCTTCAGTGCTGAGGAGG + Intergenic
1194453304 X:94071738-94071760 CTAAGTCTTCAGATCAGATGGGG - Intergenic
1195098094 X:101525150-101525172 CTGGGTATCCCCAACAGAGGTGG - Intronic
1196598656 X:117575273-117575295 CTGTGTGTTCAGAACAAAAGAGG - Intergenic
1200398886 X:156007231-156007253 CTGGGTCCTCAGATCACAGAGGG - Intronic