ID: 1063955221

View in Genome Browser
Species Human (GRCh38)
Location 10:11259212-11259234
Sequence CCTCACATGGTGCTGAAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 179}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063955221 Original CRISPR CCTCACATGGTGCTGAAGTC AGG (reversed) Intronic
901089926 1:6634457-6634479 CCACAGCTGTTGCTGAAGTCAGG - Exonic
904373129 1:30063297-30063319 TCTCTCACGGTTCTGAAGTCTGG + Intergenic
904810627 1:33161352-33161374 CCCCACATGCTGCTGCAGCCTGG - Intronic
905309499 1:37039292-37039314 CCACCCATGGTGCTGAAGAAAGG - Intergenic
911050488 1:93666847-93666869 TCTCACATGTTGATGGAGTCTGG - Intronic
912261772 1:108118093-108118115 CCTCAGATGCTTCTGGAGTCTGG - Intergenic
912747094 1:112253969-112253991 CCTCAGCTGGTGATGGAGTCAGG - Intergenic
917475948 1:175369273-175369295 CCTCCCACGGTTCTGAAGTCTGG + Intronic
918211149 1:182351914-182351936 CCTGACATCATGCTGAAGTGGGG - Intergenic
922234884 1:223715125-223715147 TCTCAAATGCTGCTGAGGTCAGG + Intronic
924669770 1:246111777-246111799 CCTCACATGGTGAAGTAGTCTGG - Intronic
1063375746 10:5553358-5553380 CCTCACTTCGTGGGGAAGTCTGG + Intergenic
1063955221 10:11259212-11259234 CCTCACATGGTGCTGAAGTCAGG - Intronic
1066565182 10:36714849-36714871 TGTCACATGGTGGTGAAGTCTGG - Intergenic
1068877191 10:62009554-62009576 CCTGGCATGTTGCTGAAGTAGGG + Intronic
1072881718 10:99234892-99234914 CCTTACAAAGTCCTGAAGTCTGG + Intronic
1075557241 10:123442539-123442561 CCTGAGAGGATGCTGAAGTCTGG - Intergenic
1076775867 10:132697714-132697736 GCTCCCATCGGGCTGAAGTCGGG + Intronic
1076908805 10:133377423-133377445 CCTGACACGGTGCTGAAAACAGG + Intergenic
1077270709 11:1678305-1678327 CCTTACCTGGTGCTGAAGCCTGG + Intergenic
1077490599 11:2859225-2859247 CCTCACCTGGGGCTGAGGCCTGG - Intergenic
1077564114 11:3285557-3285579 CTGCATCTGGTGCTGAAGTCTGG + Intergenic
1077570004 11:3331374-3331396 CTGCATCTGGTGCTGAAGTCTGG + Intergenic
1079986086 11:27202236-27202258 CCTGACAGGGTGCTTAACTCTGG + Intergenic
1080190112 11:29534946-29534968 CCTCAGATGCTGCTGAGCTCAGG + Intergenic
1081341894 11:41938116-41938138 CCTCACATGGTCATGGAGTCTGG + Intergenic
1087860122 11:103142744-103142766 CCTCAAATGTTACTGAAATCAGG + Intronic
1090852860 11:130585641-130585663 CCTCAGTTGGTGTTGAGGTCAGG - Intergenic
1091181774 11:133611458-133611480 CCTCTCATATTGCTGCAGTCAGG + Intergenic
1091677477 12:2501708-2501730 CTTCTCCTGGTGCTGAAGTCTGG + Intronic
1091785193 12:3239079-3239101 CCTCCCAGGATGATGAAGTCAGG - Intronic
1093131211 12:15393534-15393556 CCTGACATGATACTGAATTCTGG - Intronic
1093459671 12:19396769-19396791 CCTCCCATGGTGCTGAGAACAGG + Intergenic
1095687246 12:45050519-45050541 GCTCACCTGGCGCTGAAGGCTGG + Exonic
1095905892 12:47377662-47377684 CCTCAGATGGCCCTGACGTCAGG - Intergenic
1096869525 12:54584662-54584684 TATTACATGGTGCTGAAGTCTGG - Intronic
1098187131 12:67909283-67909305 CCTCAAATGGTCCTGAATTGAGG + Intergenic
1102560589 12:113759407-113759429 CCTCACATAGTGCTCCAGGCAGG + Intergenic
1102793811 12:115671335-115671357 CCTCACAGGGAGCTAAAGACAGG + Intergenic
1102996017 12:117351241-117351263 CCTCTCTTAGTGCTGTAGTCTGG + Intronic
1103920846 12:124398441-124398463 CCACACAAGCCGCTGAAGTCGGG + Intronic
1104738157 12:131152722-131152744 CCTCACATGGAGCTGACACCTGG + Intergenic
1107419739 13:40235069-40235091 ATTCACATGGTTCTCAAGTCTGG + Intergenic
1109477276 13:62897694-62897716 TATCACATGATGCTGAAGTTTGG - Intergenic
1112768574 13:102772821-102772843 CCTCCCATGGTGCTGGGGTCAGG + Intronic
1114054649 14:18956907-18956929 CATCACATAGTGATGAAATCAGG + Intergenic
1114107905 14:19445024-19445046 CATCACATAGTGATGAAATCAGG - Intergenic
1114706540 14:24732815-24732837 CCTCATATTTTGCTGCAGTCTGG + Intergenic
1116009367 14:39332828-39332850 CCTCACTGGGAGCTGAAGACCGG + Intronic
1116863015 14:50009361-50009383 CTTCACATACTGCTGAATTCGGG - Intergenic
1118761436 14:68882521-68882543 CCTCTCATTGTGCTGCTGTCGGG + Exonic
1119275452 14:73351098-73351120 TATCACATAGTGGTGAAGTCTGG - Intronic
1119621578 14:76135782-76135804 CCAAGCATGGTGCAGAAGTCTGG - Intergenic
1120186227 14:81396191-81396213 CCTCACATGATGGTGGCGTCTGG - Intronic
1125025704 15:35027021-35027043 CCTCCCAAAGTGCTGGAGTCAGG - Intergenic
1125456525 15:39865637-39865659 GATCACATAGTGGTGAAGTCAGG - Intronic
1125930013 15:43593792-43593814 CTCCACTTGGTGCTGAAATCTGG + Intronic
1125943181 15:43693624-43693646 CTCCACTTGGTGCTGAAATCTGG + Exonic
1131278564 15:91002786-91002808 CCTCACACGGTGCTAAAATGAGG + Intronic
1132717741 16:1300688-1300710 CCTGACATGGGGCTGCAGCCAGG - Intergenic
1134222395 16:12365376-12365398 CATCACATGGTGTTTATGTCAGG + Intronic
1135509959 16:23073894-23073916 CCTCCCCTGGTGCTGATGGCGGG - Intronic
1135891077 16:26358137-26358159 ACCCAGATGATGCTGAAGTCGGG - Intergenic
1139165720 16:64562996-64563018 TCTCACATGCTACTGAAGTGAGG + Intergenic
1140692061 16:77494021-77494043 CCTCAGTTCGTGCTGCAGTCAGG + Intergenic
1143616759 17:8056082-8056104 CCTAAGAAGGTGCTGAAGCCTGG + Intergenic
1146904453 17:36609059-36609081 CCTCTCATGGGGCTGCAGCCAGG - Intergenic
1147373503 17:40010462-40010484 CCCCATGTGGGGCTGAAGTCTGG + Intergenic
1147696844 17:42361499-42361521 CCTCAGATGATGCTAAAGTGAGG + Intronic
1148687553 17:49509187-49509209 CCTCAGAAGGTGCTGAAAACGGG + Intronic
1148822111 17:50365793-50365815 CATCCCATGGTGCTGAAGTAGGG - Intergenic
1151067117 17:71163108-71163130 CCTCATTTGGTGCTGAGGTGAGG - Intergenic
1153309554 18:3664772-3664794 CCAGACATGGTGCTGAACTCGGG - Intronic
1156749858 18:40438973-40438995 CCTCTCATAGGGCTGAAATCAGG - Intergenic
1158014736 18:52770946-52770968 CCTCACATGCTGAGGAAGACGGG + Intronic
1159048601 18:63395156-63395178 GCTCACATGACGCTGAAGCCAGG - Intronic
1159741897 18:72181703-72181725 CCAAACATGGGGCTGAATTCTGG - Intergenic
1160212829 18:76897059-76897081 CCCAACATGGTGCTGCAGACAGG + Intronic
1160610431 18:80080397-80080419 CCTGTTTTGGTGCTGAAGTCTGG + Intronic
1164611441 19:29635164-29635186 CCTCACTGTGTGCTGGAGTCAGG + Intergenic
1165256071 19:34577827-34577849 CCTCCCATGGTGCTGGATCCAGG + Intergenic
1165722298 19:38088163-38088185 CCTGGCACGGTGCTGAAGGCTGG + Intronic
1167800151 19:51735388-51735410 CCTCACATGGTGGTGGGGGCAGG + Intergenic
925085233 2:1102461-1102483 CGTCACATGCTGCTGAAGGGTGG + Intronic
925200215 2:1961244-1961266 CATTGCATGGTGGTGAAGTCTGG - Intronic
927375077 2:22403887-22403909 CCTCACATGGCGCTAAATGCAGG + Intergenic
936238558 2:110767508-110767530 CCTCACAAGGTTCTAGAGTCAGG - Intronic
937027886 2:118714312-118714334 GCTCTCCAGGTGCTGAAGTCCGG + Intergenic
937472938 2:122189200-122189222 CCAGACATGGGGCTGAACTCTGG + Intergenic
939378143 2:141397744-141397766 CCAGACATTGTGCTGAAGGCTGG + Intronic
940050366 2:149455939-149455961 CCTCAAAAGGTGCTGACTTCAGG + Intronic
945520969 2:210826923-210826945 CATCCTATGGTGGTGAAGTCTGG + Intergenic
946769402 2:223073204-223073226 CTTCACATGGTTCTGAGGTGGGG + Intronic
947517399 2:230818397-230818419 CCTGGGATGGCGCTGAAGTCAGG - Intronic
948806282 2:240454609-240454631 CCTCCCACGGTGCTGGAGTAGGG - Intronic
1168942208 20:1722196-1722218 CCTGACATGGAGCTTAAATCTGG - Intergenic
1170267220 20:14479705-14479727 TCTCAGATGAAGCTGAAGTCTGG - Intronic
1172456993 20:35084321-35084343 TATCGCATGGTGGTGAAGTCAGG - Intronic
1172692936 20:36803091-36803113 CCGCAGATGGAGCTGAAGACAGG - Exonic
1172971029 20:38873108-38873130 CCTCACACGGTGGGGAAGCCTGG + Intronic
1173690096 20:44954000-44954022 TTTCACATGGTGCTGCAGGCAGG - Intronic
1175708800 20:61202704-61202726 CCTCACATCCTTCTGCAGTCAGG + Intergenic
1175708918 20:61203564-61203586 CCCCAGGTGGTGCTGAATTCTGG - Intergenic
1175765679 20:61590899-61590921 CATCACATGGAGCTGGAGCCTGG - Intronic
1177678797 21:24337405-24337427 CTTCTCATAGTTCTGAAGTCTGG + Intergenic
1177701564 21:24645772-24645794 TATCATATAGTGCTGAAGTCTGG - Intergenic
1179142436 21:38738023-38738045 CTTCTCATGGTTCTGAAGGCTGG + Intergenic
1180473118 22:15679299-15679321 CATCACATAGTGATGAAATCAGG + Intergenic
1180980667 22:19876676-19876698 CCCCACAGGGGGCTGCAGTCGGG - Intronic
1181002336 22:19993742-19993764 GTCCACATGGTCCTGAAGTCTGG - Intronic
1182470067 22:30542956-30542978 CCTGACGTGGAGTTGAAGTCTGG + Intronic
1183192208 22:36328964-36328986 CCCCACACGCTGCTGAGGTCAGG - Intronic
1184035932 22:41918133-41918155 CCTCACCTGGTGCTCAGTTCTGG + Intergenic
1184256741 22:43291272-43291294 CCTCACATGGCCCTGAAGGGAGG + Intronic
950859472 3:16135036-16135058 CCTCTCATGTTGCTGTAGTCAGG + Intergenic
952390110 3:32872786-32872808 CCTCACCTGGAGATGAAGTGTGG + Intronic
954456998 3:50605084-50605106 CCTCACCTGGTGCTGCAGCCTGG - Intergenic
956033206 3:65061749-65061771 CCTTCCTTGGGGCTGAAGTCAGG - Intergenic
958903513 3:99916391-99916413 GCTCACATGATCCTGAAGGCTGG - Intronic
961125283 3:124412109-124412131 CCTCACAAGGGGCTGCTGTCTGG - Intronic
961492300 3:127264324-127264346 CAGCTCATGGGGCTGAAGTCTGG + Intergenic
966904382 3:184511212-184511234 CCTCACATGGTTCTGAGGATTGG - Intronic
967951352 3:194843388-194843410 CCTCTCATGGCCCTGAGGTCTGG - Intergenic
971386970 4:26149721-26149743 CTTCTCATGGTTCTGGAGTCTGG - Intergenic
971727349 4:30331132-30331154 CCTCACATGGAGCTGACACCTGG - Intergenic
974030915 4:56775712-56775734 CATTACATGGTGCTAAAGTTAGG - Intergenic
977088636 4:92639724-92639746 CATTACATAGTGGTGAAGTCAGG - Intronic
977574680 4:98663477-98663499 CCTCAAAAGGTGTTTAAGTCAGG - Intergenic
981881583 4:149619413-149619435 AGTTACATTGTGCTGAAGTCTGG - Intergenic
983925627 4:173398721-173398743 CCTCACATAGTTCTGAGGACTGG + Intronic
984112790 4:175641167-175641189 CCCCAGACTGTGCTGAAGTCAGG + Intronic
985224307 4:187743888-187743910 TCTCTCATGTTGCTGAGGTCTGG + Intergenic
986459115 5:7951919-7951941 TCTCACATGGTTCTGGAGGCTGG - Intergenic
989006252 5:36816052-36816074 GCTCAGATGGGGCTTAAGTCTGG - Intergenic
989225703 5:39025679-39025701 CCTCACATGGTGGGGAAATGGGG + Intronic
990145405 5:52754345-52754367 CTTCACTTGCTGCTGAAATCTGG + Intergenic
995010498 5:107252403-107252425 CCTCACATCGAGTTGAAGGCTGG + Intergenic
996285997 5:121793113-121793135 CCTCCCATTGTGCAGAACTCTGG + Intergenic
996416696 5:123218173-123218195 CCTGACACTGTGCTAAAGTCTGG + Intergenic
997666635 5:135634697-135634719 CCTCAAAAGGGGGTGAAGTCTGG + Intergenic
998827713 5:146121183-146121205 CCTTACATGATGCTAAATTCAGG + Intronic
999661140 5:153863876-153863898 CCCAACAGGGTGCTGCAGTCAGG - Intergenic
999902592 5:156101143-156101165 TATCTCATGGTTCTGAAGTCTGG - Intronic
1000345149 5:160308026-160308048 CCTATGATGGTGTTGAAGTCAGG - Intronic
1001111577 5:168901037-168901059 CATCACAGGGTGATGAAGTCAGG - Intronic
1001221597 5:169905041-169905063 ACTCTCATGGGGCTGAGGTCAGG + Intronic
1003387294 6:5680541-5680563 CCTCATGTGGTGCTGATGGCAGG - Intronic
1004572783 6:16863894-16863916 CCTCATAGGGTGCTGATGTGTGG + Intergenic
1004764279 6:18708146-18708168 ACTCACATTGTGCTGTAGTGTGG - Intergenic
1008612566 6:53197724-53197746 TATCACGTGATGCTGAAGTCTGG + Intergenic
1008860206 6:56139807-56139829 CATCACATGGTGCTCCGGTCTGG + Intronic
1009295099 6:61937105-61937127 CATCTCATGGTGCTGCATTCTGG + Intronic
1010029089 6:71254474-71254496 GTTCCCATGGTGATGAAGTCAGG + Intergenic
1014833429 6:126129449-126129471 CCTCACATGGTGCCTGACTCAGG + Intergenic
1015126735 6:129763301-129763323 CCTGGAATGGAGCTGAAGTCTGG - Intergenic
1016024436 6:139271837-139271859 GCCCAGATGGTGCTGAAGTCAGG + Intronic
1020103287 7:5407460-5407482 GCTCACCTGGTGGGGAAGTCAGG - Intronic
1020626821 7:10591363-10591385 TATCACATGATGCTGAGGTCTGG - Intergenic
1021124848 7:16839763-16839785 CCTAACATCTTGCTGAAGTTAGG - Intergenic
1023348823 7:39299225-39299247 CCTCACCTGCTTTTGAAGTCGGG + Intronic
1023505046 7:40890473-40890495 CCTCAGATGGGGCAGAAGCCTGG - Intergenic
1024360875 7:48466854-48466876 CCTCACATTGTGCCCTAGTCAGG - Intronic
1025087002 7:56031355-56031377 TATCACATGATGCTGAAGTTTGG - Intronic
1025722248 7:64027378-64027400 CATCACTTGGTGCTGAAGCAGGG + Intergenic
1029165332 7:98585216-98585238 CTTAACATGGTCCTGAAGTCAGG + Intergenic
1031693421 7:124818567-124818589 CCTCATCTGCTGCTGGAGTCTGG - Intergenic
1032177998 7:129648690-129648712 CCTTACATGGTGAGGGAGTCAGG - Intronic
1032794038 7:135263411-135263433 CCTCACATGGTTCTGACACCTGG - Intergenic
1034296943 7:149982018-149982040 GCTCAGATGTTGCCGAAGTCAGG + Intergenic
1034809083 7:154114830-154114852 GCTCAGATGTTGCCGAAGTCAGG - Intronic
1035369109 7:158367510-158367532 ACTCACACTGTGCTGGAGTCAGG + Intronic
1035987741 8:4453380-4453402 CAGAACTTGGTGCTGAAGTCAGG + Intronic
1036417991 8:8568105-8568127 CCTCAAATAGTGCTGAAGAGCGG - Intergenic
1039490033 8:37940460-37940482 CATCGCATAGTGGTGAAGTCAGG - Intergenic
1042820227 8:72922565-72922587 CCTCACATGGTGGAAAAGGCAGG + Intronic
1042943849 8:74135113-74135135 CATTGCATAGTGCTGAAGTCTGG - Intergenic
1045654552 8:104373575-104373597 CCTCCCATGGAGGTGAAGACAGG + Intronic
1047332907 8:123908277-123908299 CCTCACCTGGGGGTGAAGACTGG + Intronic
1050798606 9:9579757-9579779 TATCACATAGTGGTGAAGTCAGG + Intronic
1051379389 9:16439957-16439979 CCCCAGATGATCCTGAAGTCCGG + Intronic
1051438964 9:17062618-17062640 CCTCAAATGCTGCTGGTGTCTGG + Intergenic
1051495492 9:17718349-17718371 TGTGGCATGGTGCTGAAGTCAGG + Intronic
1056112462 9:83409146-83409168 CCTCAAATGGGGCTGCATTCTGG - Intronic
1058603903 9:106700500-106700522 CCTCATATGTTGGTAAAGTCAGG - Intergenic
1060851983 9:126885597-126885619 CTTCATATGGTGATGAAGTGTGG - Exonic
1062680888 9:137779492-137779514 CCACACATGAAGCTGAAGGCTGG - Intronic
1062680908 9:137779569-137779591 CCACACATGAAGCTGAAGGCTGG - Intronic
1186750353 X:12615220-12615242 CATCACTTTGTGCTGAATTCAGG - Intronic
1189641347 X:43075384-43075406 CCTCACATTTTGCAGAACTCAGG + Intergenic
1197003277 X:121465526-121465548 CCTCAACTGGTGTTGAGGTCTGG + Intergenic
1199983353 X:152933240-152933262 CCTCACATGGTGCTGGTCTTGGG + Intronic
1200925357 Y:8649468-8649490 CCTCACATTGTGCTGTTGGCAGG - Intergenic
1200948351 Y:8867910-8867932 CCTCACATTATGCTGTTGTCAGG - Intergenic
1202345464 Y:23919069-23919091 CCTCCCAAAGTGCTGGAGTCAGG - Intergenic
1202525306 Y:25751020-25751042 CCTCCCAAAGTGCTGGAGTCAGG + Intergenic