ID: 1063956634

View in Genome Browser
Species Human (GRCh38)
Location 10:11273366-11273388
Sequence TCTAAACTGCACATGCTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063956626_1063956634 25 Left 1063956626 10:11273318-11273340 CCGTCAGATCAGCGGCAGCCTTG 0: 1
1: 0
2: 11
3: 61
4: 184
Right 1063956634 10:11273366-11273388 TCTAAACTGCACATGCTGAAGGG No data
1063956629_1063956634 7 Left 1063956629 10:11273336-11273358 CCTTGGAATCTCCTAGGAGCACG 0: 1
1: 0
2: 2
3: 11
4: 84
Right 1063956634 10:11273366-11273388 TCTAAACTGCACATGCTGAAGGG No data
1063956631_1063956634 -4 Left 1063956631 10:11273347-11273369 CCTAGGAGCACGAACCTGGTCTA 0: 1
1: 0
2: 0
3: 6
4: 47
Right 1063956634 10:11273366-11273388 TCTAAACTGCACATGCTGAAGGG No data
1063956624_1063956634 29 Left 1063956624 10:11273314-11273336 CCTCCCGTCAGATCAGCGGCAGC 0: 4
1: 95
2: 725
3: 1171
4: 1567
Right 1063956634 10:11273366-11273388 TCTAAACTGCACATGCTGAAGGG No data
1063956625_1063956634 26 Left 1063956625 10:11273317-11273339 CCCGTCAGATCAGCGGCAGCCTT 0: 1
1: 82
2: 727
3: 1171
4: 1541
Right 1063956634 10:11273366-11273388 TCTAAACTGCACATGCTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063956634 Original CRISPR TCTAAACTGCACATGCTGAA GGG Intronic
No off target data available for this crispr