ID: 1063957131

View in Genome Browser
Species Human (GRCh38)
Location 10:11277414-11277436
Sequence TCCAGGGAGGTGAGGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 823
Summary {0: 1, 1: 0, 2: 8, 3: 81, 4: 733}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063957131_1063957140 17 Left 1063957131 10:11277414-11277436 CCCTCTGCCCTCACCTCCCTGGA 0: 1
1: 0
2: 8
3: 81
4: 733
Right 1063957140 10:11277454-11277476 TGGATACTCTTCCGTGCTCCAGG No data
1063957131_1063957141 26 Left 1063957131 10:11277414-11277436 CCCTCTGCCCTCACCTCCCTGGA 0: 1
1: 0
2: 8
3: 81
4: 733
Right 1063957141 10:11277463-11277485 TTCCGTGCTCCAGGAGAGCATGG No data
1063957131_1063957139 -3 Left 1063957131 10:11277414-11277436 CCCTCTGCCCTCACCTCCCTGGA 0: 1
1: 0
2: 8
3: 81
4: 733
Right 1063957139 10:11277434-11277456 GGATGCTTCAGGATACTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063957131 Original CRISPR TCCAGGGAGGTGAGGGCAGA GGG (reversed) Intronic
900082173 1:866623-866645 GTCAGGGATGTGAGTGCAGAGGG - Intergenic
900082197 1:866721-866743 GTCAGGGATGTGAGTGCAGAGGG - Intergenic
900082247 1:866917-866939 GTCAGGGATGTGAGTGCAGAGGG - Intergenic
900365935 1:2312016-2312038 TCCAGGGAGCTGAGGCTGGAGGG - Intergenic
900408116 1:2501295-2501317 TCCAGGGCGCAGAGGCCAGAGGG - Intronic
900992009 1:6102422-6102444 ACCAAGACGGTGAGGGCAGAGGG + Exonic
901167186 1:7229303-7229325 GCCGGGAAAGTGAGGGCAGATGG + Intronic
901218902 1:7571046-7571068 TCCATGAAGGTGAAGGCAGTTGG - Intronic
901770799 1:11529485-11529507 TCAGGGGAGGTGAGGCCAGCAGG - Intronic
901822975 1:11842124-11842146 TCCAGGAAGGGGCGGGGAGAGGG - Exonic
902255721 1:15187436-15187458 TGCAGGAGGCTGAGGGCAGAGGG + Intronic
902987831 1:20166245-20166267 TCCAGGGAGGCGTGGGAGGACGG - Intronic
903020060 1:20387326-20387348 CCAAGGGGGATGAGGGCAGAAGG + Intergenic
903375597 1:22863831-22863853 TTCAGGAGGCTGAGGGCAGAAGG - Intronic
903432052 1:23312303-23312325 ACCAGGATGGTCAGGGCAGAGGG - Intronic
903893129 1:26583469-26583491 TCCTGGGAGGAGAGGGTACAGGG + Intergenic
903929427 1:26853881-26853903 TCCCGGCAGGTGAGTGCGGAGGG - Exonic
904194965 1:28778359-28778381 TCCAGAGAGGTGAGAGATGAAGG + Intergenic
904370798 1:30046248-30046270 TCCAGGGGAGGGAGGGCAGCTGG + Intergenic
904472726 1:30746030-30746052 GCCAGGGAAGGGTGGGCAGATGG - Intronic
904676181 1:32200640-32200662 TCCCGGGAGGAGAGGGCGGAGGG + Exonic
905241781 1:36586282-36586304 TCGTGGGAGGGGAGGGGAGAAGG + Intergenic
905273401 1:36801699-36801721 TCCTGGCAGGTAAGGGCAGGAGG + Exonic
905340888 1:37276552-37276574 CTCAGGGAGGTGCAGGCAGAGGG + Intergenic
905399533 1:37691700-37691722 TCCAGGGAGCCCAGGGCAGGAGG - Intronic
905780567 1:40705392-40705414 TCCTGGGAAGAGAAGGCAGAAGG - Intronic
906070673 1:43014006-43014028 CCCAGGGAGGAGAGTGCAAAAGG + Intergenic
906607553 1:47182516-47182538 TCCAGAGAAGTGGGGCCAGAAGG - Intergenic
906704079 1:47882035-47882057 TCCAGGCTTCTGAGGGCAGAAGG - Intronic
907326021 1:53638957-53638979 GGCAGGGAGTGGAGGGCAGAAGG + Intronic
907485489 1:54775047-54775069 ACCTGGTGGGTGAGGGCAGAGGG + Intergenic
910292099 1:85609258-85609280 TTCAGGGAGGTGTGGGAAGGAGG - Intergenic
910883155 1:91940723-91940745 TCCTGGGAGGTGAGGTGGGAGGG - Intergenic
910886875 1:91973157-91973179 TAGAGTGAGGTAAGGGCAGAGGG + Intronic
911058854 1:93730809-93730831 TCAAGGGAGGTGGGGGAAGGAGG - Intronic
912025003 1:105159192-105159214 TACTGGGAGGTGAGGTCTGATGG - Intergenic
912448910 1:109757930-109757952 ACCAGGGAGGTGAGTACTGAGGG - Exonic
912451576 1:109770656-109770678 TCCAGGGCTGTCAGGGCAGTGGG - Intronic
912518946 1:110232383-110232405 CCCAGGGTGGTGACAGCAGATGG + Exonic
912644016 1:111373387-111373409 TCCAGGGAGCTTAGAACAGAGGG + Intergenic
912966134 1:114239308-114239330 TCCAGTGAGGTCAATGCAGAAGG + Intergenic
913118070 1:115714813-115714835 TGCACTGAGGTGAGGGCAGGGGG - Intronic
913609479 1:120496205-120496227 GCCATGGAGGTGAGTGGAGATGG + Intergenic
913961273 1:143339647-143339669 TCCAGGGGGCTGAGTTCAGAGGG + Intergenic
913985980 1:143566483-143566505 GCCATGGAGGTGAGTGGAGATGG - Intergenic
914055626 1:144165220-144165242 TCCAGGGGGCTGAGTTCAGAGGG + Intergenic
914123520 1:144801142-144801164 TCCAGGGGGCTGAGTTCAGAGGG - Intergenic
914204344 1:145514311-145514333 GCCATGGAGGTGAGTGGAGATGG - Intergenic
914240502 1:145849681-145849703 TCTAGTGAGGTGATGACAGAGGG + Exonic
914483466 1:148087499-148087521 GCCATGGAGGTGAGTGGAGATGG - Intergenic
914581711 1:149025634-149025656 GCCATGGAGGTGAGTGGAGATGG - Intronic
914843642 1:151268032-151268054 TGCAGGGAGGTGCTGGCAGGAGG - Intergenic
915109234 1:153552603-153552625 TTCTGGGAGGTGAGGCCTGAGGG + Intergenic
915369486 1:155336603-155336625 TTCAGGAGGGTGAGGGAAGATGG + Exonic
915580739 1:156811681-156811703 TGAAGGCGGGTGAGGGCAGAGGG - Intronic
915587048 1:156849487-156849509 TGCGGGGAGGTGGGGGCAGGGGG + Intronic
915634745 1:157178257-157178279 TCCTGGGAAGGGAGGGCAGTTGG + Intergenic
916575723 1:166064691-166064713 TCCAAGTAGATGAGGCCAGAGGG + Intronic
916655994 1:166875976-166875998 TCCAGGGCGGTGAGTTCAGGTGG + Intronic
916840830 1:168598975-168598997 TCAAGGGAAGTGAAGGCAAAGGG - Intergenic
917687171 1:177428709-177428731 TCTACAGAGGTGAAGGCAGAAGG - Intergenic
917805901 1:178613575-178613597 TCCAGGCAGGAGAAGGCTGAGGG + Intergenic
918101688 1:181381976-181381998 AGCATGGAGGTGAGAGCAGAAGG + Intergenic
919118762 1:193313623-193313645 TCCTCAGAGGTGAGGGCAGAGGG + Intergenic
920154241 1:203935391-203935413 CCCAGAGAGGTGAGAGAAGATGG + Intergenic
920444423 1:206005181-206005203 CCCAGAGATGTGGGGGCAGAAGG - Intergenic
920550351 1:206855442-206855464 TCAAGGGTGGGGAGGGCGGATGG + Intergenic
920676426 1:208041451-208041473 TCCAGGAAGCTGAGCTCAGAAGG + Intronic
920869649 1:209783512-209783534 TCCAGCTAAGTGAAGGCAGATGG + Exonic
921490839 1:215773698-215773720 CCCAGGCAAGTGAGGGCAAAAGG - Intronic
921570989 1:216777948-216777970 ACCAGGTAGGTGAAGGCAGGTGG - Intronic
921900715 1:220447742-220447764 TCCAAGGAGGTGATGGAGGAGGG + Intergenic
922718186 1:227887578-227887600 GCCAGGGAGGTGAGGGCCAAAGG - Intergenic
923033381 1:230267405-230267427 AACATGGAGGTGAGGGCAGCCGG - Intronic
923140049 1:231153765-231153787 TGCAGGGAGGTGAGGAGGGAGGG - Intergenic
923368783 1:233289553-233289575 TTCAGGCAGGTGAGGGCAGGAGG + Intronic
924383559 1:243483713-243483735 TCCAGGGAGGAGAGGGGTCAGGG - Intronic
1063137642 10:3231241-3231263 TTCAGGGAGGTGAAGACACAAGG - Intergenic
1063346638 10:5318159-5318181 TCCAGGGATGTGAGGGACCAAGG - Intergenic
1063364326 10:5480659-5480681 TCCAGGGAGGGGAAGGCAGGAGG - Intergenic
1063957131 10:11277414-11277436 TCCAGGGAGGTGAGGGCAGAGGG - Intronic
1064067918 10:12199400-12199422 TGAAGGGAGGTCAGGGCATAGGG - Intronic
1064143733 10:12810961-12810983 CCCAGGGGGCTGAGGGGAGAGGG + Intronic
1064265294 10:13820910-13820932 TCCAGAGAGATGGGGGCAGACGG - Intronic
1065367997 10:24953190-24953212 TGGAGGGAGGTGAGGGGAGGTGG - Intergenic
1065368005 10:24953210-24953232 TGGAGGGAGGTGAGGGGAGGTGG - Intergenic
1065498543 10:26355118-26355140 TCAAGAGAGGTGTGGGGAGAAGG - Intergenic
1065636852 10:27742955-27742977 TCCAGGCAGCGGAGGGCCGAGGG + Intronic
1066179225 10:32943559-32943581 AACAGGGAGGTGAGAGGAGAGGG + Intronic
1066290707 10:34012143-34012165 TCCAGGTAGGAGAGAGTAGATGG - Intergenic
1066374400 10:34844326-34844348 TCCAGGGAGGAGAGGGCATCTGG + Intergenic
1066457835 10:35587041-35587063 ACCAGGGAGGTGCGTGCACAGGG - Intergenic
1067029724 10:42872045-42872067 TCCAGGGGGCTGAGTTCAGAGGG + Intergenic
1067570503 10:47368021-47368043 CCCAGGGAGGTGAGGGTGGGTGG + Exonic
1068681652 10:59826528-59826550 TCCAGGGAGGCCAGTGCTGAGGG - Intronic
1068866777 10:61903178-61903200 GCGGGGGAGGGGAGGGCAGAGGG + Intronic
1068929159 10:62571252-62571274 TCCAAGCAGCTCAGGGCAGAAGG - Intronic
1069629232 10:69887850-69887872 TCCAGCGAGGGGGAGGCAGAGGG + Intronic
1069754033 10:70762294-70762316 CCCAGGGAGGGGAGGGCAACAGG - Exonic
1069770096 10:70893187-70893209 ACCAGGGAGGTGAGCTCACAGGG + Intergenic
1069823203 10:71240010-71240032 TCCAGGCGGGTGAGGGAAGGTGG + Intronic
1069838399 10:71324000-71324022 TCCAGAGAGGTGGGGGCAGTAGG + Intronic
1069882656 10:71603385-71603407 TCAAGAGAGGTCAGGGCACAGGG - Intronic
1070055188 10:72927677-72927699 TCGAGGGGGCTGAGGTCAGAGGG - Intronic
1070634800 10:78116711-78116733 TCCATGGAGGAGCAGGCAGAAGG + Intergenic
1070642567 10:78180178-78180200 TCCAGGGAAGAGAGAGGAGAGGG + Intergenic
1071138827 10:82483067-82483089 TCCAGGAAAGGCAGGGCAGATGG + Intronic
1072187954 10:93060419-93060441 TCGAGGGCGGGGACGGCAGAGGG + Intergenic
1072905764 10:99451771-99451793 TCAAGGGTGCTGTGGGCAGAAGG - Intergenic
1073112221 10:101069574-101069596 TGAAGGCAGCTGAGGGCAGAGGG + Intergenic
1073140373 10:101243295-101243317 TCATGGGAGGTGAGGGCGAAGGG + Intergenic
1073858110 10:107701246-107701268 TCCAGAGAGGTGAGGGGAGAGGG - Intergenic
1074107542 10:110399768-110399790 TCCAGGGAGGTGAGGCAGGAGGG + Intergenic
1074526518 10:114267797-114267819 TGCAGGAAGGTGAGGGAGGAGGG + Intronic
1075548270 10:123372733-123372755 CACAGGGAGGTCAGGCCAGAAGG + Intergenic
1076490468 10:130858044-130858066 TGCCAGGAGGTGATGGCAGAGGG - Intergenic
1076605781 10:131689141-131689163 GCCTGGGAGGTGGGGGCAGGTGG - Intergenic
1076795008 10:132794140-132794162 TCCAGGGGGGTGAGGGCCCCCGG + Intergenic
1076856705 10:133119352-133119374 ACCAGGGTGGTGGTGGCAGAAGG + Intronic
1076985527 11:233298-233320 TCAGGGGAGGGGAGCGCAGAAGG + Intronic
1077051691 11:569459-569481 GCCAGGGAGCTGAGGGGAGACGG - Intergenic
1077190061 11:1252217-1252239 TCCAGGGAAGGGAGTGGAGAGGG - Intronic
1077400285 11:2352257-2352279 TCTAGGGCTTTGAGGGCAGAAGG - Intergenic
1077548910 11:3190744-3190766 GGAAGGGAGGGGAGGGCAGAAGG + Intergenic
1078085798 11:8232431-8232453 TACAGGGAGGTGTGGGGAAATGG + Intronic
1078088678 11:8250574-8250596 TCCAGGGAGCAGTGGGCAGTGGG - Intronic
1078093058 11:8279468-8279490 ACCAGGGAGCTAAGGGCAGGTGG + Intergenic
1078376131 11:10794759-10794781 TCCAGTGTGGTGGGAGCAGAAGG + Intergenic
1078381910 11:10850080-10850102 TCCAAGGAGGTTAGGGGAAAAGG + Intronic
1079007878 11:16804901-16804923 TGCAGGGAGGTGTGGGGAGGTGG + Intronic
1079734139 11:23974260-23974282 TCCTTGGAGGGAAGGGCAGAGGG - Intergenic
1080374359 11:31690328-31690350 TGAAGGAAAGTGAGGGCAGATGG - Intronic
1080791994 11:35529700-35529722 TGGTAGGAGGTGAGGGCAGAGGG - Intronic
1080860487 11:36146217-36146239 TCCAGGGAGGTAAGTGCACAGGG - Intronic
1081649696 11:44815529-44815551 TCTGGGGAGTTGAGGGCTGATGG + Intronic
1081854467 11:46295105-46295127 GCCAGGGACCTGAGGGAAGAGGG + Intronic
1082849573 11:57753279-57753301 TCGAGGGACTTGAGGGCTGAGGG + Intronic
1083285587 11:61656615-61656637 TGCAGGGTGGTGAGGGTACAGGG + Intergenic
1083443042 11:62689598-62689620 ACCAGGGAGGTGGGGGGAGGAGG - Exonic
1083654712 11:64224029-64224051 AGGAGAGAGGTGAGGGCAGAAGG + Intronic
1083697028 11:64449816-64449838 GCCCAGGATGTGAGGGCAGAGGG - Intronic
1084150341 11:67285204-67285226 GCCAGGGATGGGAGGGCCGAGGG + Intronic
1084485774 11:69447334-69447356 TCCCGGGAGGGGAGGAGAGAAGG + Intergenic
1084686704 11:70700384-70700406 TCAATGGAGTGGAGGGCAGAGGG - Intronic
1084714653 11:70865977-70865999 ACCAGGGAGGAGAGGGCCCAGGG - Intronic
1084797964 11:71520864-71520886 TCCAGGGAGGCCAAGGCAGGAGG - Intronic
1085038789 11:73314863-73314885 ATCAGGGACCTGAGGGCAGAAGG - Intronic
1085392602 11:76190067-76190089 GCCCGGGAGGGGAGGGGAGAGGG + Intronic
1085726219 11:78957022-78957044 TCCAGAGAGATGAGGGATGAAGG - Intronic
1085772854 11:79340307-79340329 CCCAGGGAGGTGGGGTCAGGGGG + Intronic
1086208857 11:84293950-84293972 TCCAGGGAGGGAAGGAAAGATGG - Intronic
1086983233 11:93221636-93221658 TACAGGCAGGTGTGGGCAAAAGG - Intergenic
1087202841 11:95363522-95363544 TCATGGGAGATGAGGCCAGAGGG + Intergenic
1087208365 11:95420304-95420326 TCCAGGGAGGTGAGAGGAGCTGG - Intergenic
1087307253 11:96501663-96501685 TCCAAGGCGGTGATGGCAGTGGG - Intronic
1088352782 11:108909178-108909200 TCCAGGGAGGTGGGGGGAATAGG - Intronic
1088683547 11:112265803-112265825 TCCAGGGAGCTGGGGGTAGCTGG + Intronic
1088692177 11:112337530-112337552 ACCAGGGAGGTAGTGGCAGAGGG - Intergenic
1089296175 11:117469693-117469715 ACCAGGGAGGAGAGGGAAGTGGG + Intronic
1089337502 11:117735102-117735124 TGCAGGGTGGAAAGGGCAGATGG + Intronic
1089508983 11:118983814-118983836 TCCAGGGAGGCCAAGGCAGGTGG - Intergenic
1089680562 11:120116842-120116864 TCCAGGGAGCTCTGGGGAGAAGG + Intronic
1089836201 11:121372805-121372827 TTCAGAGAGGTCAGGGTAGAGGG + Intergenic
1090083808 11:123633420-123633442 TCCAGCCAGTTAAGGGCAGAGGG + Exonic
1090267360 11:125361758-125361780 TCATGGGAGGTGGGAGCAGATGG - Intronic
1090488840 11:127139994-127140016 TCCAGGGAGGTCAGAGGAGGAGG - Intergenic
1091332292 11:134739387-134739409 CCCATGGAGGTGAGGGGTGAGGG - Intergenic
1091361038 11:134978599-134978621 GCGAGGGAGGGAAGGGCAGAGGG + Intergenic
1091588469 12:1829157-1829179 TCCAGGGAGGTGGGGGGCGCAGG + Intronic
1091748761 12:3009948-3009970 CCCGGGGAGGTGAGGGGAGTGGG - Intronic
1092045823 12:5431437-5431459 TCAAGGGAGGTCAAGGTAGAGGG - Intergenic
1092951848 12:13510977-13510999 TCCATGAAGGTGAGAGCAGATGG + Intergenic
1093226644 12:16492429-16492451 TGCTGGGAGGAGAGGTCAGACGG - Intronic
1094491450 12:30963403-30963425 ACCAGGGAAGTGCGGACAGAGGG + Intronic
1095616485 12:44195808-44195830 ACCAGGGAGGCCAAGGCAGAAGG + Intronic
1096122387 12:49096805-49096827 GCCAGGGAGGATAGGGCTGAAGG + Exonic
1096743771 12:53712641-53712663 CCCAGGGAAGTCAGGGAAGAGGG + Intronic
1096749055 12:53747365-53747387 TGCAGGGAGGGGAGGGCCAAGGG - Intergenic
1096980956 12:55728199-55728221 TCCACAGTGGTGAGGGCTGAGGG - Intronic
1097040577 12:56153753-56153775 GCCAGGGGAGTGAGGGCAGGCGG + Intronic
1097080131 12:56423877-56423899 TCCAGGGAGGTGTGGCCTGAAGG - Exonic
1098863547 12:75736426-75736448 ACCAGGGAGGTGAGGCTGGATGG - Intergenic
1100201301 12:92300415-92300437 TCCAGGGTGATCAGAGCAGAGGG + Intergenic
1101092827 12:101305077-101305099 TGCAGGGAGTTGTGGGGAGACGG - Intronic
1101428139 12:104604524-104604546 GCCAGGGAGTTGAGGAGAGAAGG + Intronic
1101479818 12:105085449-105085471 TCCAGAGAGGTGAGGGAGAAGGG - Intergenic
1101710001 12:107256462-107256484 CCCAGGGAGGGGAGGGGAAAGGG - Intergenic
1102433038 12:112898452-112898474 TGCAGGGAGCTGAGGGTGGAGGG - Exonic
1102436246 12:112926228-112926250 TGCTGGGAGGTGGAGGCAGAAGG - Intronic
1102553609 12:113711063-113711085 TCCCTGGAGCTGAGGGCAGAGGG - Intergenic
1102658342 12:114502706-114502728 TCCTGGGAGATGGGGGCACAGGG - Intergenic
1102674678 12:114649614-114649636 TCCTGAGGGGTGAGGGCTGAAGG - Intergenic
1103000907 12:117384729-117384751 AACTGGGAGATGAGGGCAGAGGG + Intronic
1103188297 12:118980418-118980440 TCCAGGAAGGCAAGGGCTGAGGG + Intergenic
1103534787 12:121626886-121626908 TCCGGGTAGGTGACGGCGGACGG - Exonic
1103745727 12:123122132-123122154 CCCAGGGAGCTGGGGGCAGGAGG - Intronic
1103762969 12:123264780-123264802 TCCAAAGAGGTGACAGCAGAGGG + Intronic
1103937641 12:124484980-124485002 TCCAGGGAGGTGAGCACAGAGGG - Intronic
1104088088 12:125493873-125493895 TCCAGGGAGGAGGGGGAGGAGGG - Intronic
1104088123 12:125493972-125493994 TCCAGGGAGAAGAGGGAGGAGGG - Intronic
1104088141 12:125494040-125494062 TCCAGGGAGGAGGGGGAGGAGGG - Intronic
1104088162 12:125494108-125494130 TCCAGGGAGGAGGGGGAGGAGGG - Intronic
1104088184 12:125494177-125494199 TCCAGGGAGGAGGGGGAGGAGGG - Intronic
1104088208 12:125494246-125494268 TCCAGGGAGGAGGGGGAAGAGGG - Intronic
1104088219 12:125494280-125494302 TCCAGGGAGGAGGGGGAGGAGGG - Intronic
1104088243 12:125494348-125494370 TCCAGGGAGGAGGGGGCGGAGGG - Intronic
1104088311 12:125494543-125494565 TCCAGGGAGGAGAGGGAGGAGGG - Intronic
1104088362 12:125494707-125494729 TCCAGGGAGGAGGGGGAGGAGGG - Intronic
1104088390 12:125494785-125494807 TCCAGGGAGGAGGGGGAAGAGGG - Intronic
1104088406 12:125494828-125494850 TCCAGGGAGGAGGGGGAGGAGGG - Intronic
1104088420 12:125494862-125494884 TCCAGGGAGGAGGGGGAGGAGGG - Intronic
1104088432 12:125494896-125494918 TCCAGGGAGGAGGGGGGAGAGGG - Intronic
1104088454 12:125494964-125494986 TCCAGGGAGGAGGGGGAGGAGGG - Intronic
1104088466 12:125494998-125495020 TCCAGGGAGGAGAGGGAGGAGGG - Intronic
1104088520 12:125495171-125495193 GCCAGGGAGGAGGGGGAAGAGGG - Intronic
1104088565 12:125495307-125495329 TCCAGGGAGGAGGGGGAGGAGGG - Intronic
1104205827 12:126637485-126637507 TCTATGCAGGTGAGGGTAGAGGG - Intergenic
1104299255 12:127549331-127549353 TCCAGGGAGAGGTGGGCAGGAGG + Intergenic
1104546581 12:129718338-129718360 TCCAGGGAGGGGAGGGGAAGGGG + Intronic
1104848716 12:131860787-131860809 ACCTGGGATGTGAGGGAAGAGGG + Intergenic
1105205764 13:18222132-18222154 TGCAGAGAACTGAGGGCAGAGGG + Intergenic
1105834094 13:24193276-24193298 TCCAGTGAGCTGGGGGCACAAGG + Intronic
1105904860 13:24797789-24797811 TCCAGGCAGCTCAGGGCACAAGG - Intronic
1105907896 13:24832300-24832322 TCCAGGAAAGTGAGGGGAGGTGG + Intronic
1107737082 13:43410814-43410836 TCAAAGTAGGTGAGGGTAGATGG - Intronic
1108601972 13:52002564-52002586 GGCAGGGAGGCGAGGGGAGAGGG + Intronic
1108668247 13:52653519-52653541 TTCAGGGACGTGAGGGAAAAGGG - Intronic
1111650722 13:91087726-91087748 TTTAGTAAGGTGAGGGCAGAGGG - Intergenic
1111997150 13:95176207-95176229 TCCAGGAAGCCGAGGGCAGGGGG + Intronic
1112041701 13:95553424-95553446 TCAAGGGAGGTCAGGACAAACGG - Intronic
1112130441 13:96517445-96517467 CCCAGGGAGATGGGGGGAGAGGG + Intronic
1112291014 13:98143735-98143757 TCGGCGGAGGTGAGGGGAGAGGG - Intronic
1113184751 13:107675211-107675233 ACCAGGGACGTAAGAGCAGAAGG - Intronic
1113279112 13:108769286-108769308 GCCAGAGAGGTTGGGGCAGAAGG + Intronic
1113416550 13:110132786-110132808 GCCAGGGAGGCCAGGGCACAGGG + Intergenic
1114410792 14:22498474-22498496 TCCAGTGAAGGGAGGGCAGCAGG + Intergenic
1116838799 14:49798067-49798089 TCCTGGCAGGTCAGGGCAAAAGG - Intronic
1117120956 14:52568049-52568071 CCCAGGGAGATCAGCGCAGAAGG + Intronic
1117272968 14:54163782-54163804 TCCAGGGAGGGGAGAGGAGCTGG - Intergenic
1117758776 14:59004366-59004388 TCCAGGGAGGAGAGAGGAGCTGG - Intergenic
1118435265 14:65765383-65765405 CCCAGGGAGGGGAGGTTAGATGG + Intergenic
1118839792 14:69501713-69501735 TCCTGGGGAGGGAGGGCAGATGG - Exonic
1119044273 14:71303902-71303924 TCCAGGAAGATGAGGCTAGAAGG - Intergenic
1119459634 14:74789458-74789480 CCCAGGGAGGCCAAGGCAGATGG - Intronic
1120752378 14:88209714-88209736 TCCAGGAAGGGTAGGACAGAGGG + Intronic
1121599178 14:95190503-95190525 GGCAGGGAGGAGAGAGCAGAGGG + Exonic
1121601019 14:95203022-95203044 TCCAGGGAGGAGGAGGCCGATGG - Exonic
1122101705 14:99416701-99416723 TACTGGGAGGTGTGGGCTGAGGG - Intronic
1122174941 14:99909862-99909884 CTCAGGGAGGTGGTGGCAGATGG - Intronic
1122297480 14:100713551-100713573 TGCGGAGAAGTGAGGGCAGAAGG + Intergenic
1122366582 14:101198106-101198128 GCCAGTGAGGAGAGGGCAGGTGG + Intergenic
1122738972 14:103859874-103859896 TGCAGGGAGGTGGGTGCCGAGGG - Intergenic
1122873350 14:104651364-104651386 GCCAGGGAGGTGAGGGCTGTGGG - Intergenic
1123014926 14:105369067-105369089 TCCAGGGAGGCCAGCGCAGGTGG + Intronic
1124129374 15:26971161-26971183 TGCTGGGAGGTGGGGGCAGCTGG - Intergenic
1124322579 15:28726141-28726163 CCCAGGGAGGTGGAGGCAGGTGG - Intronic
1124497477 15:30195554-30195576 TCAAGGGAGGAGGGGGCAGTCGG + Intergenic
1124746096 15:32343111-32343133 TCAAGGGAGGAGGGGGCAGTCGG - Intergenic
1124973846 15:34515179-34515201 TCAAGGGAGGAGGGGGCAGCCGG - Intergenic
1125385812 15:39135394-39135416 TCCAGTAAGGTTAGAGCAGAGGG + Intergenic
1125530735 15:40411855-40411877 TCCAGGAAGTCCAGGGCAGATGG + Intronic
1126634099 15:50765352-50765374 GCCGCGGAGGTGCGGGCAGAGGG + Intronic
1126681109 15:51202975-51202997 TTCAGGATGGTGAGTGCAGATGG + Intergenic
1126901063 15:53314695-53314717 GCCAGGCAGCTGAGGCCAGAAGG - Intergenic
1126968597 15:54083997-54084019 TCCAGGGCTGTGAGTGCAGGGGG + Intronic
1127072100 15:55297055-55297077 TCCAGAGAGGGGAGGGTAAAGGG + Intronic
1127202194 15:56666887-56666909 TCCTTGGAGGTGAGAGCTGAAGG + Exonic
1127567452 15:60205738-60205760 TCCAGAGAGGTGAGGACACAAGG + Intergenic
1127582571 15:60351179-60351201 TCCATGAAGGTAAGGGCAGCTGG - Exonic
1128228999 15:66021951-66021973 TCCAGGGAAGGGCGGGCACAGGG + Intronic
1128595262 15:68940255-68940277 TCCAGGGAAGTGAGAGGAAAAGG - Intronic
1128669083 15:69560855-69560877 GTCAGGGAGGTGAAGACAGAAGG + Intergenic
1128728108 15:70002637-70002659 TCCAGGGAGCTCAGGGCAAAGGG + Intergenic
1129225710 15:74169261-74169283 TCAGGGGAGGGGAGGGAAGAAGG + Intergenic
1129657959 15:77537182-77537204 TCCAGAAAGCTGAGGGCAGGGGG - Intergenic
1129946097 15:79540511-79540533 TCCAGTGAAATGGGGGCAGAAGG - Intergenic
1130655295 15:85788362-85788384 GACAGGGAGGTGTGGGAAGATGG - Intronic
1130733406 15:86522951-86522973 GCCAGGAAGGTGGAGGCAGAAGG - Intronic
1131048326 15:89330193-89330215 TCCAGGGGGATGAGGTCAGCCGG + Exonic
1131066786 15:89439684-89439706 TAGAGAGAGGTGATGGCAGAGGG - Intergenic
1131346619 15:91655578-91655600 TCCTGAGAGGTGAAGGCAGCTGG + Intergenic
1132069746 15:98765862-98765884 TCCAGCAGGGAGAGGGCAGATGG + Intronic
1132302367 15:100784008-100784030 CCCAGGGAGGTGTGGACGGAGGG + Intergenic
1132660406 16:1058484-1058506 CCCAGGCAGGTTGGGGCAGACGG - Intergenic
1133026809 16:2992163-2992185 CCCAGCCAGGTGAGGGCAGCTGG + Intergenic
1133027869 16:2996523-2996545 TCCAGCCAGGTGAGGGCAGCTGG + Intergenic
1133410916 16:5568169-5568191 TCGAGGAAGGAGAGGGCACAGGG - Intergenic
1133646744 16:7771510-7771532 TTCAGGGAGGTTAAGGCACATGG - Intergenic
1134017047 16:10895920-10895942 TCCAGGGAAGAGAGGGGAGATGG + Intronic
1134092745 16:11400169-11400191 GACAGGGAGATGAGGTCAGATGG - Intronic
1134630071 16:15750040-15750062 TCGGGGTAGGTGGGGGCAGAGGG + Intronic
1135031603 16:19043120-19043142 TCAAGGGAGGTGGGCGGAGACGG - Intronic
1135571083 16:23549763-23549785 ACCAGGGATGTGAGGATAGAAGG - Intronic
1135880282 16:26249008-26249030 GCCGGGGAGTTGAGGGGAGAGGG - Intergenic
1136098228 16:27974150-27974172 TTCAGGGAGGGGACAGCAGAGGG + Intronic
1136374302 16:29856273-29856295 TCCAGGGAGGTTGGGGGAGTGGG - Intergenic
1136417570 16:30113157-30113179 GCTGGGGAGGTGAGGCCAGAGGG - Intronic
1137934074 16:52617128-52617150 CCCAGGGAGGTGAGTACAAAGGG + Intergenic
1139149015 16:64358104-64358126 TCCAGGGAGTTAGGGACAGAGGG - Intergenic
1140428919 16:74884868-74884890 TCCAAGGAGCTGAGGTCTGAAGG - Intronic
1140477663 16:75247093-75247115 TACTGTGAGGTGGGGGCAGAGGG - Intronic
1140703885 16:77607979-77608001 TCCTGGGAGGCCAAGGCAGATGG - Intergenic
1141185497 16:81784180-81784202 TAGAGGGAGGTGGGGGCAAAGGG + Intronic
1141191864 16:81830883-81830905 TCCAGGCAGGAGAGGGGAGATGG + Intronic
1141730215 16:85817362-85817384 GCCAGGGGGGCCAGGGCAGAAGG - Intergenic
1141743818 16:85912817-85912839 TCCAGGGCGTTGAGGGCAATTGG + Intronic
1142149294 16:88505671-88505693 TCCCGGGAGCTGACGGCAGGGGG - Intronic
1142223075 16:88864810-88864832 TCCAGGAACATGAGCGCAGAGGG - Intronic
1142314127 16:89332743-89332765 ACTAGGGAGGTCAGGGCAGCGGG - Intronic
1142497551 17:314430-314452 TCAATGGAGGTGGGGGCAGAGGG - Intronic
1142497708 17:315249-315271 TCAATGGAGGTGGGGGCACAGGG - Intronic
1142497747 17:315403-315425 TCAATGGAGGTGGGGGCACAGGG - Intronic
1142497840 17:315829-315851 TCAATGGAGGTGGGGGCACAGGG - Intronic
1142497849 17:315860-315882 TCAATGGAGGTGGGGGCACAGGG - Intronic
1142497863 17:315922-315944 TCAATGGAGGTGGGGGCACAGGG - Intronic
1142497887 17:316014-316036 TCAATGGAGGTGGGGGCACAGGG - Intronic
1142497931 17:316227-316249 TCAATGGAGGTGGGGGCACAGGG - Intronic
1142498034 17:316772-316794 TCAATGGAGGTGGGGGCACAGGG - Intronic
1142498043 17:316803-316825 TCAATGGAGGTGGGGGCACAGGG - Intronic
1142498150 17:317348-317370 TCAATGGAGGTGGGGGCACAGGG - Intronic
1142498170 17:317442-317464 TCAATGGAGGTGGGGGCACATGG - Intronic
1142498182 17:317505-317527 TCAATGGAGGTGGGGGCACAGGG - Intronic
1142596650 17:1032979-1033001 TCTAGAGAGGTGAGGACAGGGGG + Intronic
1142992385 17:3740001-3740023 TACAGGGAGGTGAGGGGTGCAGG + Intronic
1143331672 17:6141386-6141408 GCCAGGGAGCAGAGGTCAGAAGG + Intergenic
1143461973 17:7109542-7109564 TCTAGGGAAGCGAGGGCAAAGGG - Intronic
1143649751 17:8256231-8256253 TGCAGGGAGGGGAAGGCAGGTGG - Intronic
1143711760 17:8740627-8740649 GCCACTGAGTTGAGGGCAGAGGG + Intronic
1144388619 17:14772852-14772874 TCCAGGCAACTGAGAGCAGAAGG + Intergenic
1144623337 17:16832071-16832093 TCCAGGGAAGTGGTGGCAGAGGG - Intergenic
1144830323 17:18127471-18127493 ACCAGGAAGGTGAGGCCAGGTGG - Intronic
1144883094 17:18440645-18440667 TCCAGGGAAGTGGTGGCAGAGGG + Intergenic
1145149136 17:20503741-20503763 TCCAGGGAAGTGGTGGCAGAGGG - Intergenic
1146180924 17:30697765-30697787 TTGAGGGAGGTGCGGGAAGATGG - Intergenic
1146184763 17:30717547-30717569 TGGAAGGAGGTGAGGGCAGCTGG - Intergenic
1146967770 17:37047492-37047514 AACAGGGAGGAGAGGGGAGAGGG - Intronic
1147159984 17:38564052-38564074 TCCAGGGAGTGAAGAGCAGAGGG + Intronic
1147162230 17:38574912-38574934 GCCATGGAGGTGGGAGCAGAGGG + Intronic
1147443675 17:40462314-40462336 GGTAGGGAGGTGAGGGCAGCGGG - Intergenic
1147610880 17:41801280-41801302 AGCAGGGAGGTGGGGGCAAAGGG - Intergenic
1147740707 17:42669757-42669779 TCCAGGGATGTGAGGGCCCAAGG + Intronic
1148652010 17:49257073-49257095 TCCAGGGAGGTCATGGCAGGTGG - Intergenic
1148732663 17:49846985-49847007 TGCAGTGAGGAGAGGGCAGCAGG - Intronic
1148747562 17:49927163-49927185 CCCAGAGAGGTGAGGACAGGAGG - Intergenic
1148821099 17:50360181-50360203 TCCAGGGAGGGGCAGGGAGAGGG - Exonic
1148858324 17:50591222-50591244 GGCAGGGAGGAGAGGGCGGAGGG + Intronic
1149481942 17:57010679-57010701 CCCAGGGAGGTGGGGGGTGAAGG - Intergenic
1150207010 17:63416785-63416807 TCCAGGGTGCTGAGGGAAGTGGG + Intronic
1150854190 17:68734804-68734826 TCAAGGGGGTTGAGGGCAGAGGG - Intergenic
1151384134 17:73744800-73744822 CCCAGGGAGCTGTGGGGAGATGG + Intergenic
1151557616 17:74854574-74854596 GGCAGGGAGGTGGGGGCTGAGGG - Intronic
1151624258 17:75266837-75266859 GCCAGGGAGCTGAGGCCAGTTGG + Exonic
1151824952 17:76519054-76519076 TCCAGAGCAGTGAGGACAGATGG - Intergenic
1151977152 17:77489453-77489475 CACAGGGAGCTGAGGACAGAGGG - Intronic
1152007017 17:77688644-77688666 TCTAGGGAGCAGAGAGCAGAGGG - Intergenic
1152089551 17:78239193-78239215 TCCAGGCAGCTGAGAGCAGGAGG - Exonic
1152093083 17:78257662-78257684 TGCAGAGAGGGGAGGGAAGAGGG - Intergenic
1152126154 17:78448253-78448275 TACAGGGAGGTTGAGGCAGAAGG + Intronic
1152140205 17:78532075-78532097 CTCAGGGAGATGAGGGCTGAGGG - Intronic
1152153312 17:78616420-78616442 TACAGGGTGGAGAGGGCAGGGGG + Intergenic
1152157360 17:78643660-78643682 GCAAGGGAAATGAGGGCAGAAGG - Intergenic
1152157759 17:78646079-78646101 TCCGGGGAGGTGTGGCCAGGAGG + Intergenic
1152228972 17:79105295-79105317 CCCAGGGAGTTGATGGCGGATGG + Intronic
1152252071 17:79217539-79217561 TCGAGGGAGCTGCAGGCAGAGGG + Intronic
1152252360 17:79218669-79218691 TGCAGGGAGGTCAGGGAACAGGG + Intronic
1152517852 17:80836703-80836725 TGGAGGGAGGTGCCGGCAGAGGG + Intronic
1152524456 17:80879510-80879532 TCCAGGGCAGTGAGGGAAGAAGG - Intronic
1152584787 17:81184108-81184130 GCCAGGGTGGTGCGGGCAGTGGG - Intergenic
1152855360 17:82662519-82662541 GGGAGGGAGGTGAGGGCAGGTGG + Intronic
1152898464 17:82926826-82926848 TGCAGGGAGGAGAGGGCATATGG - Intronic
1152924720 17:83081537-83081559 TCCAGGCAGGTGACAGCAGCGGG + Intronic
1152946417 17:83200055-83200077 TCCAGGGAAGTGGGGACAGTCGG + Intergenic
1153273726 18:3348351-3348373 TCCAGGGAGAGGAGCTCAGAGGG + Intergenic
1153389920 18:4544753-4544775 TCCCGGGAGCTCAGGGCACAAGG - Intergenic
1153599741 18:6768732-6768754 TTCAGGGAGGCTAAGGCAGATGG - Intronic
1153618312 18:6953854-6953876 TCCTAGGAGGAGAGGGCGGATGG + Intronic
1153795481 18:8618118-8618140 ATCAGGGAGGGGAGGACAGAGGG - Intronic
1154086721 18:11312877-11312899 TCGGCGGAGGTGAGGGCAGATGG - Intergenic
1155317778 18:24589645-24589667 TCTAGGAAGCTAAGGGCAGATGG + Intergenic
1156449839 18:37260839-37260861 TCCAGGGAGGGGAGGCCGAAGGG - Intronic
1156499518 18:37548722-37548744 TGCAGTGATGTGAGAGCAGAAGG + Intronic
1157317330 18:46603279-46603301 AGCAGGGAGTTGAGGGGAGAGGG + Intronic
1157404066 18:47408956-47408978 TCCAGAGAGGTGAGGGAACTTGG + Intergenic
1157688354 18:49661063-49661085 TCCAGGGAGGGGAGAGAAGCTGG + Intergenic
1157802012 18:50628363-50628385 CCCAGGGAGGCGAGATCAGACGG - Intronic
1158657524 18:59352640-59352662 TCCTGGGAGTTGGGGGAAGAGGG - Intronic
1159008667 18:63038084-63038106 TCCAGGTACGTGGGGACAGATGG - Intergenic
1159985491 18:74836276-74836298 TCCACGGAGGAAAGGGGAGAGGG - Intronic
1160425114 18:78773921-78773943 CCCAGGCAGGTGAGGGCCGTGGG - Intergenic
1160503844 18:79416594-79416616 TCCCAGGAGGTGATGGCAGCGGG - Intronic
1160620780 18:80169179-80169201 GGTAGGGAGGTGTGGGCAGAGGG - Exonic
1160674141 19:379856-379878 GGGAGGGAGGTGGGGGCAGAAGG + Intergenic
1160674906 19:384870-384892 GGGAGGGAGGTGGGGGCAGAAGG + Intergenic
1160674916 19:384912-384934 GAGAGGGAGGTGGGGGCAGAAGG + Intergenic
1160674929 19:384954-384976 GGGAGGGAGGTGGGGGCAGAAGG + Intergenic
1160674941 19:384996-385018 GGGAGGGAGGTGGGGGCAGAAGG + Intergenic
1160674953 19:385038-385060 GGGAGGGAGGTGGGGGCAGAAGG + Intergenic
1160799230 19:960170-960192 TCCAGCGGGGTGGGGGCAGAGGG - Intronic
1160822306 19:1064270-1064292 TCCAGGCAGGTGTGGGGTGAGGG + Intronic
1160863015 19:1245512-1245534 TCCAGGGGGGTGAGTGGGGAGGG + Intergenic
1162013352 19:7830777-7830799 TCCTGAGAGATCAGGGCAGAAGG - Intronic
1162208832 19:9075798-9075820 TGCAGGGAGGTGGGGGAAGGAGG - Intergenic
1162570073 19:11466468-11466490 TCTAGGGATGTGAGGTCTGATGG - Intronic
1162745009 19:12793166-12793188 TGCAGAGAGGGGAGGGCAGGGGG - Exonic
1162831315 19:13286474-13286496 CCCAGTGATGTGAGAGCAGAGGG + Intronic
1162931424 19:13959669-13959691 TCCAGGTGGGTGTGGGCAGTGGG + Exonic
1162977658 19:14217767-14217789 TTGAGGGAGGTGCGGGAAGATGG + Intergenic
1163267238 19:16228512-16228534 TCCTAGGAGGGCAGGGCAGAGGG + Intronic
1163758703 19:19121420-19121442 ACCTGGGGGGTGAGGGCAGGAGG + Exonic
1163790075 19:19301393-19301415 TCCAGGCAGACGAGGGCAGTGGG - Intronic
1163809408 19:19421252-19421274 GCCAGGGAGGTGAGGGCAGTAGG + Intronic
1163860243 19:19738997-19739019 GGCAGAGAGCTGAGGGCAGAGGG - Intergenic
1164202586 19:23030882-23030904 TCTGGGGAGGAGAGGTCAGATGG + Intergenic
1164719777 19:30423834-30423856 GTCAGGGAGGTGGGGGCAGGTGG + Intronic
1165309743 19:35022929-35022951 TGCAGGGAGGGGAGGGCAGGGGG - Intronic
1165788704 19:38477898-38477920 TGCAGGGTGGGGAGGGCAGGAGG + Intronic
1166349851 19:42191457-42191479 ACAAGGGAGGTGAAGGCAGCAGG - Intronic
1166377045 19:42333543-42333565 TGCAGGGAGGTGTGGGGAGAAGG + Intronic
1166655928 19:44611871-44611893 TCCAGGGAGGTGAGGGGCCCAGG - Intergenic
1167244435 19:48365054-48365076 TCCAGAGAGGTGAGGGCCTGGGG - Intronic
1167257039 19:48436850-48436872 GCTTGGGAGATGAGGGCAGATGG + Intronic
1167424906 19:49425182-49425204 TTCAGGTAGGAGAGGGTAGAGGG + Intronic
1167640339 19:50678349-50678371 TCCAGGCAGGAGAGGACAGCTGG + Intronic
1167644232 19:50697082-50697104 CCCAGGGAGGTGAGAGGCGAGGG - Exonic
1168007686 19:53504455-53504477 TCCAGGGCGGTGTGGGTGGAGGG - Intergenic
1168062829 19:53902996-53903018 TCCCAGGGGGTGAGGCCAGAGGG + Intronic
1168305142 19:55431152-55431174 TCCTGGGAGGTGGTGGCACATGG + Exonic
1168306142 19:55437390-55437412 TCCTGGGAGGGGAGACCAGAAGG + Intronic
1202695109 1_KI270712v1_random:117897-117919 TCCAGGGGGCTGAGTTCAGAGGG + Intergenic
925006198 2:444847-444869 TCCCGGGAGAAGAGGGCACAGGG - Intergenic
925158242 2:1663152-1663174 TCCAAGGATGAGCGGGCAGACGG + Intronic
925592599 2:5525512-5525534 TCCAGGCAGGTGCGGACAGGAGG - Intergenic
926508494 2:13744918-13744940 CCCAGGGAGATGAATGCAGAAGG + Intergenic
926606742 2:14905746-14905768 TTCAGGGAGGTAAGGATAGAGGG + Intergenic
927929787 2:27036752-27036774 TCCAGGTATGTGATGGCAAAGGG - Exonic
928029895 2:27769230-27769252 TCAAGAGAGGAGAGGGGAGAGGG - Intergenic
928097305 2:28412526-28412548 TCCAGGGCCGTGAGGGCAAGAGG + Exonic
928106952 2:28476703-28476725 TCCAGGGAGGTGATGGCCACAGG + Intronic
928177321 2:29043587-29043609 GTCAGGTAGGTGAGGGCAGGTGG - Intronic
928865822 2:35916575-35916597 TACAGGGAGGTCATGACAGAAGG + Intergenic
929712517 2:44279382-44279404 TCCAGGATGGTGTGGGCAAAGGG - Intronic
929823348 2:45290998-45291020 TAAAGGGAAGTGAGGGGAGAAGG - Intergenic
930355083 2:50308254-50308276 GTCAGGGAGGTGGGGGGAGATGG - Intronic
931186715 2:59959577-59959599 TCCAGGGATGGGAGGGCAGAGGG - Intergenic
931670084 2:64639911-64639933 GCCTGGAAGGGGAGGGCAGAGGG + Intronic
931712768 2:65003428-65003450 GCCAGGGATGTGAGGCAAGATGG - Intronic
932171872 2:69564926-69564948 TGCAGGGAGGTGGGGGTGGAAGG - Intronic
932305117 2:70696432-70696454 GCAAGGAAGGGGAGGGCAGATGG - Intronic
932411737 2:71551582-71551604 GCCAGGGAGGTCAGGTCACAAGG - Intronic
932771995 2:74505644-74505666 AGCAGGGAGGGGAGGGAAGAGGG + Intronic
932777933 2:74539638-74539660 TGCAGGGAGGTGAAGGGAGCAGG - Intronic
933652563 2:84861110-84861132 TACAGGGAGGTGAGGCCAATAGG + Intronic
933691484 2:85182373-85182395 GCCAGGGAGCTGAGGGTAGAAGG + Intronic
934050946 2:88210340-88210362 TCCAGGGAGGTGGTGGCATCTGG + Intergenic
934276279 2:91574946-91574968 TCCAGGGGGCTGAGTTCAGAGGG + Intergenic
934654868 2:96112263-96112285 CCCAGGGAGGGGAGGGAGGAAGG - Intergenic
934656389 2:96118615-96118637 TGCAGGGTGGGGAGGGCACACGG - Intergenic
934924307 2:98371284-98371306 TGCAGGGAGGTGGGGACTGAGGG - Intronic
936038539 2:109130571-109130593 GCTAAGGAGGGGAGGGCAGAAGG + Intronic
936499129 2:113051739-113051761 TCCAGGGAGCCGTGAGCAGAAGG - Intronic
936639108 2:114292665-114292687 TCCAGGACGGTGATGTCAGAAGG - Intergenic
937044426 2:118843666-118843688 TCCGGGGCGGTGAGGACAGCAGG - Intronic
937110542 2:119363780-119363802 TCCTGGGAGGTCGAGGCAGAGGG + Intronic
937253634 2:120539941-120539963 GCCAGGGAGGACAGGGCAGTGGG + Intergenic
937327670 2:121001265-121001287 CACAGTGAGGTGAGGGCACAGGG - Intergenic
937439973 2:121907305-121907327 TCAAGGTAGGAGAGGGGAGATGG - Intergenic
937509808 2:122582958-122582980 ACCAGGGAGGGGAGGGGAGGTGG + Intergenic
937775536 2:125771035-125771057 ACCAGGGAAGTGTGGGTAGAAGG - Intergenic
937869083 2:126774906-126774928 TCCAGTGAGCTGTGAGCAGAAGG + Intergenic
938036687 2:128040573-128040595 TTAAGGGAGGAAAGGGCAGAAGG - Intergenic
938149044 2:128865432-128865454 TCCAGGGAGATGAAAGCAGTTGG - Intergenic
938257757 2:129873192-129873214 TTCAGGGAGAGGAGAGCAGAAGG - Intergenic
938306898 2:130262738-130262760 TGCAGGGAAAGGAGGGCAGAGGG - Intergenic
938318968 2:130349882-130349904 TCCGGGGCAGTGGGGGCAGAGGG - Intergenic
938422618 2:131156596-131156618 CCCTGTGAGGTGGGGGCAGAAGG + Intronic
938770834 2:134499453-134499475 TCCAGGGCTGTGTGGGCAAATGG - Intronic
939522332 2:143246654-143246676 TCCTTGGAGGAGAGGGCAGGTGG + Intronic
940946309 2:159622158-159622180 ACCAGGGAGGCCAAGGCAGAAGG + Intergenic
941885915 2:170527211-170527233 TCCAGTGAGAAGAAGGCAGAGGG + Intronic
942427733 2:175877313-175877335 TGCAGGGAAGTGAGAACAGAGGG + Intergenic
942743552 2:179206672-179206694 TCCAGGGAGTAGGGGGCAAATGG + Intronic
943626364 2:190205591-190205613 TAAAGGCAGGGGAGGGCAGAGGG + Intronic
943731553 2:191308016-191308038 TCCAGGGAGGGGAGGGGAGCTGG - Intronic
944506226 2:200414389-200414411 TACTGGGAGGTCAAGGCAGAAGG + Intronic
945063676 2:205930231-205930253 TCCGGGGAGGAGAGGCCAGTTGG - Intergenic
945198090 2:207256099-207256121 TCCAAGGCGGTGAAGGCAGGAGG + Intergenic
945681464 2:212918951-212918973 TCCAGGTAGGAGAGAGCAGATGG + Intergenic
946103041 2:217343491-217343513 TCCAGGGAGGGGCAGGGAGAAGG - Intronic
946212925 2:218162091-218162113 TCCAGGCAGGTGAGTGAGGAGGG - Intergenic
947467188 2:230361749-230361771 ACAAGGGAGGTGAGGGCCCAAGG + Intronic
947807729 2:232980247-232980269 TCCTGGGAGGTCAGGACACAAGG + Intronic
947940630 2:234051864-234051886 TCCAGGCAGCAGAGGCCAGATGG + Intronic
948371787 2:237494264-237494286 GCCAGAGAGTGGAGGGCAGAGGG + Intronic
948505486 2:238424787-238424809 TCTGGAGAGGTGAGGTCAGAGGG + Intergenic
948602733 2:239116523-239116545 TCCAGGCAGGAGAGGCCAGGTGG - Intronic
948680725 2:239632889-239632911 TCCAGGGAGCAGATGGCAGAGGG - Intergenic
1168804156 20:662910-662932 GCTAGAGAGGTGAGGGCAGCTGG + Exonic
1168914277 20:1473701-1473723 TCTGGGGAGATGAGGTCAGAGGG + Intronic
1169235625 20:3927719-3927741 GCCTGGGAGGGAAGGGCAGATGG + Intronic
1169398763 20:5261151-5261173 TGCAGGGATGGGAGGGCAGAAGG + Intergenic
1169422759 20:5473178-5473200 TGCAGGGAGGAGAGGGGAGCAGG - Intergenic
1169481063 20:5981246-5981268 TCCAGAGAGGTATAGGCAGACGG + Intronic
1169726825 20:8743553-8743575 TGCAGGGAGGTGAGGCAAGCAGG - Intronic
1170651417 20:18245970-18245992 AGCAAGGAGGTGAGGGCAGACGG - Intergenic
1170703908 20:18727985-18728007 TCCAGGGAGCTTAGGTGAGAAGG + Intronic
1171363003 20:24603390-24603412 AGCAGGGAGGTGAGGGCTGGAGG + Intronic
1171773987 20:29349061-29349083 TCCTGGAAGGTCTGGGCAGAAGG - Intergenic
1172007433 20:31827014-31827036 TGGAGGGATGGGAGGGCAGAGGG - Intronic
1172033106 20:31995410-31995432 TGGAGGGTGGTGAGGGTAGAAGG - Intronic
1172182188 20:33010271-33010293 TACAGAGAGGTGAGGGCACCTGG - Intronic
1172362633 20:34324741-34324763 TGAAGTGAGCTGAGGGCAGAGGG + Intergenic
1172420025 20:34808224-34808246 TCCAGGGAAGGTAGGGCAGGAGG - Intronic
1172518357 20:35551559-35551581 ACCCTGGAGGTGAGGGCAGATGG + Intronic
1172645597 20:36467336-36467358 TCCAGGGAGGTGGGTGCAGAGGG + Intronic
1172660218 20:36562940-36562962 TCCAGAGAGGAAAGGGGAGAGGG + Intergenic
1173250659 20:41362676-41362698 GCCAGGGAGGTGAGCGGGGATGG + Exonic
1173471433 20:43326337-43326359 TGCAGGGAGGTGAGGAAGGATGG - Intergenic
1173932917 20:46836815-46836837 TTCAGGGAGGTGATGGGAGTAGG + Intergenic
1174421874 20:50404618-50404640 TGCATGGAGGTGAGGGGGGAAGG - Intergenic
1174460649 20:50680061-50680083 TCCAGGGAGCTCCTGGCAGAGGG - Intronic
1174670606 20:52304325-52304347 ACCAGGGTGGTGGGGGCAGGGGG + Intergenic
1174687738 20:52471868-52471890 TTCAGTGGGGTGGGGGCAGAGGG - Intergenic
1175138329 20:56841569-56841591 CCCTGGGAAGTGAGGGCAGCAGG - Intergenic
1175404255 20:58716597-58716619 TCCAGGGCTGTGGGGGCACATGG - Intronic
1175547879 20:59791019-59791041 ACCAGGGAGGTGAGGGTAGAAGG + Intronic
1175853368 20:62105496-62105518 TGCAGGGAGGTGGGGGGAGCAGG - Intergenic
1175879008 20:62245955-62245977 TCCAGGGAGGTCTGGGAAGGAGG + Intronic
1176115735 20:63431133-63431155 TCCAGGCAGGGGAGGGCCCAGGG + Intronic
1176119904 20:63449719-63449741 TCCTGGGAGAAGAGGGAAGAGGG + Intronic
1176653822 21:9572504-9572526 TCCTGGGAAGAGAGGGCAGGAGG + Intergenic
1179605773 21:42514257-42514279 TCCGGGGAAGTGGAGGCAGAGGG + Exonic
1180004325 21:45013125-45013147 CCCAGGGAGGTGAAAGCAGATGG + Intergenic
1180131711 21:45830919-45830941 GCCCGGGAGAGGAGGGCAGAGGG - Intronic
1180741858 22:18059027-18059049 TCCAGCCTGGTGAGGACAGAAGG + Intergenic
1180760203 22:18196584-18196606 TGCAGAGAACTGAGGGCAGAGGG - Intergenic
1180770517 22:18380882-18380904 TGCAGAGAACTGAGGGCAGAGGG - Intergenic
1180775465 22:18428112-18428134 TGCAGAGAACTGAGGGCAGAGGG + Intergenic
1180808535 22:18739167-18739189 TGCAGAGAACTGAGGGCAGAGGG + Intergenic
1180828459 22:18883840-18883862 TGCAGAGAACTGAGGGCAGAGGG - Intergenic
1181071462 22:20344131-20344153 TGCAGAGAACTGAGGGCAGAGGG + Intergenic
1181194533 22:21173081-21173103 TGCAGAGAACTGAGGGCAGAGGG + Intergenic
1181214909 22:21319697-21319719 TGCAGAGAACTGAGGGCAGAGGG - Intergenic
1181461591 22:23089078-23089100 TCCTGGGAGGTGAGGAGGGAGGG + Intronic
1181463047 22:23096564-23096586 TCCAGCAAGGTGGGGGCAGAGGG + Intronic
1181716511 22:24734416-24734438 TCAAGAGAGGTGAGGACACAGGG + Intronic
1182357958 22:29730703-29730725 TCCAGGGCGGGGATGGCAGATGG + Exonic
1182370378 22:29806292-29806314 TGCAGGCAGATGAGAGCAGATGG + Intronic
1182557879 22:31138801-31138823 TGCAGGGAGGGGAGGGGAGAGGG + Intronic
1183104991 22:35609290-35609312 TGCAGGGAGGGGCTGGCAGATGG + Intronic
1183315210 22:37133283-37133305 TGCAGGGAGCTGTGGGCGGAGGG + Intronic
1183392986 22:37556410-37556432 TGCATGGAAGGGAGGGCAGATGG + Intergenic
1183663418 22:39234348-39234370 TGCTGGGAAGTGAGGGCTGAGGG + Intronic
1183748149 22:39704114-39704136 CCCTGGGAGGGGAGGGGAGAAGG + Intergenic
1184281552 22:43440406-43440428 GCCAGGGTGCTGAGGGCAGGAGG + Intronic
1184920857 22:47604819-47604841 TCTTGGGAGGTGCTGGCAGAGGG - Intergenic
1184973661 22:48045820-48045842 TCCAGGGAGGTGGAGGCTGCAGG - Intergenic
1185037604 22:48488160-48488182 TCCAGGGAGGTGAAGGGATGTGG - Intergenic
1185226839 22:49658136-49658158 GCCAGGGAGGAGATGGCAGAGGG - Intergenic
1185238780 22:49729666-49729688 TCCAGGGAGGTTAAGGCTGTGGG - Intergenic
1203232352 22_KI270731v1_random:122054-122076 TGCAGAGAACTGAGGGCAGAGGG - Intergenic
1203278556 22_KI270734v1_random:109829-109851 TGCAGAGAACTGAGGGCAGAGGG - Intergenic
949605581 3:5649640-5649662 TGCTGGGAGTTGAGGGGAGAGGG + Intergenic
950213766 3:11143080-11143102 TGAAAGGAGGTGAGGACAGAGGG + Intronic
950358944 3:12436964-12436986 TCCAGGGAGGTGCTGGGGGAGGG - Intergenic
950454376 3:13083975-13083997 CCCAGGGAGGTGAGGGGAAGGGG + Intergenic
950499466 3:13354561-13354583 TTTGGGAAGGTGAGGGCAGAGGG - Intronic
950997551 3:17518997-17519019 TGCAAGGAGTTGAGAGCAGAGGG + Intronic
951577461 3:24128321-24128343 CCCAGGGACTTGAAGGCAGAGGG + Intronic
952184830 3:30957335-30957357 TCCAGGGAGGTCAGGGTGGGAGG - Intergenic
952210869 3:31227999-31228021 TCTGGGGAGCTGAGGGTAGAAGG + Intergenic
952306180 3:32148421-32148443 TGCAGGGAGGTGGGGGTTGAAGG + Intronic
952603244 3:35110244-35110266 TTCAGGCAGGTGAGGGAAGAAGG - Intergenic
952889706 3:38031711-38031733 CCCTGGGAGTTGAGGGCAGAGGG - Intergenic
953118506 3:40016126-40016148 TCCAAGGAGAAGAGGACAGAAGG - Intronic
953787687 3:45923032-45923054 TGGAGGGAGATGAGGCCAGAGGG - Intronic
954132373 3:48567216-48567238 CTGAGGGAGGTCAGGGCAGAAGG - Intronic
954181053 3:48881582-48881604 TCCAGGGAGGTGAACACAGCAGG + Intronic
954654922 3:52188512-52188534 TCCAGATAGGTGAGGACAGTGGG - Intergenic
954891809 3:53937424-53937446 TCCAGGCAGGGGAAGGCAGCTGG + Intergenic
955073616 3:55592392-55592414 TCCCAGAAGGAGAGGGCAGAGGG - Intronic
955444478 3:58994866-58994888 TTCCGGCAGGTGAGGGAAGAAGG + Intronic
955449107 3:59048868-59048890 TCCAGTGAGGTGAGGAAAGCAGG + Intronic
955719770 3:61868424-61868446 GCCAGGGAGCTGGGGGCAGGGGG - Intronic
957491808 3:80937076-80937098 TATATGGAGGTTAGGGCAGAGGG - Intergenic
957720476 3:83990749-83990771 TCCAGAGAGGTGAGGGGGAAGGG - Intergenic
957939912 3:86991201-86991223 GACAGGGAGGCGGGGGCAGAGGG + Intergenic
959568353 3:107856037-107856059 TCCAAGGGGGTCAGGGCAAAGGG - Intergenic
961918931 3:130405638-130405660 TCCAGGGGCGTGGGGTCAGAAGG + Exonic
962257099 3:133879915-133879937 TCCAGGGAAGCTATGGCAGAGGG - Intronic
963001697 3:140687611-140687633 TCCAAGGAGGTGAATGAAGAGGG - Intronic
963061033 3:141226914-141226936 AACAGGGAGGTGTGGGCTGAAGG + Intergenic
963881446 3:150533264-150533286 AGATGGGAGGTGAGGGCAGAGGG - Intergenic
966915616 3:184582724-184582746 TTAAGGGAGCTGAGGGTAGAGGG + Intronic
967275216 3:187767811-187767833 ACCAGGAAGGTGAAGGCTGATGG + Intergenic
967284904 3:187859442-187859464 TCAAGGCAGGTCAGTGCAGACGG + Intergenic
967892395 3:194372534-194372556 CCCTGGAAGGTGAGGGGAGAGGG + Intergenic
968479439 4:826800-826822 TACGGGGAGGTCGGGGCAGAGGG - Intergenic
968652792 4:1766840-1766862 GCCAGGAGGGTGAGGGCAGGCGG - Intergenic
968673407 4:1864298-1864320 TCCAAGGAGGGGAGGGAAGGAGG - Intergenic
968970535 4:3791359-3791381 CCAGGGAAGGTGAGGGCAGACGG - Intergenic
970609875 4:17714980-17715002 TGCAGGGAGGTGAGGGGAAGGGG - Intronic
972726093 4:41747286-41747308 TCCGGGGAGGTGTGGGGTGAGGG - Intronic
973645324 4:52944831-52944853 TCCAGGGAGGGGACTTCAGAAGG - Intronic
973744469 4:53949845-53949867 TTTTGGGAGGTCAGGGCAGAAGG + Intronic
976603627 4:86962077-86962099 GCCAGGGAGTTGAGAGCAAAGGG + Intronic
976689096 4:87849263-87849285 TCCAGGAAGGTGAGGTTTGAGGG - Intergenic
976903617 4:90208899-90208921 CCCAGGGAGATAAAGGCAGAAGG - Intronic
977401724 4:96541125-96541147 TCTGGGAAGGAGAGGGCAGAAGG + Intergenic
977663551 4:99618434-99618456 TCCAGGGAAGTAAGGGGAGGAGG - Intronic
977995243 4:103492961-103492983 GCCAGGGAGGTTAGGCCTGATGG + Intergenic
978719690 4:111893869-111893891 TCCAGGGAGGTGAGAGTGGCTGG - Intergenic
980722525 4:136716914-136716936 TGCAGGGAAGGGAGGGCAGAGGG - Intergenic
981843252 4:149136644-149136666 TCCAGGGAGGGGAAGGCCCAAGG + Intergenic
983513570 4:168634009-168634031 TCCTGTGATGTGATGGCAGATGG + Intronic
985715917 5:1461494-1461516 TGCTGGGGTGTGAGGGCAGAGGG - Exonic
985770410 5:1806426-1806448 GCCAGGCAGGTGAGGCCACAGGG - Intronic
986196965 5:5546218-5546240 ACCAGGGAGGAGAGGGCTGGTGG - Intergenic
986437224 5:7746076-7746098 TCCAGGGACGGGAGGGCAGGAGG - Intronic
987245169 5:16041532-16041554 CCCAGGGCTGTGGGGGCAGAGGG - Intergenic
987354009 5:17046371-17046393 TCCAGGGAAGTCTGGGTAGAGGG - Intergenic
987520051 5:18970164-18970186 AGCAGTGAGGTGAGGGCAGAGGG + Intergenic
988121517 5:26968913-26968935 TTCAGTGAGGTGAGGACAGATGG - Intronic
989077118 5:37575484-37575506 TCCAGGGAGAGGAGTGAAGATGG + Intronic
989224841 5:39014725-39014747 TCCAGTGAGATGATGTCAGAAGG + Intronic
989391476 5:40905209-40905231 CCAAGGGAGGTGAGGGCAAATGG + Intergenic
989963313 5:50441000-50441022 TCCAGGGTAGGGAGGGCGGAGGG - Intronic
990148774 5:52792248-52792270 TCCAGTGAGGAGATGGGAGATGG + Intronic
990703490 5:58500718-58500740 TGCTGGGAGGTGGGGGCAGGGGG - Intergenic
991212128 5:64118020-64118042 TCCAGGGAGGAGGTGGGAGATGG + Intergenic
991422217 5:66453237-66453259 TTCAGGGAGGGGAGGACAGGTGG - Intergenic
991560510 5:67946689-67946711 TCCATGCAGGAGATGGCAGAAGG + Intergenic
992869248 5:80990031-80990053 GCCAAGGTGGAGAGGGCAGATGG + Intronic
994926619 5:106124038-106124060 GCCATAGACGTGAGGGCAGAGGG - Intergenic
996457248 5:123698962-123698984 GTCAGGGAGGTGAGGGCAGGGGG - Intergenic
996790641 5:127290231-127290253 GGCGGGGAGGTGAAGGCAGAGGG - Intergenic
996801303 5:127406575-127406597 ATCAGTGAGGTTAGGGCAGAGGG + Intronic
997427237 5:133811751-133811773 CCCAGGGGTGTGAGGGTAGATGG - Intergenic
997645352 5:135477963-135477985 GCCAGGGAGGAGTGGACAGAGGG - Intergenic
997778143 5:136629762-136629784 TCCTGTGAGGTGAGGGCTGGGGG - Intergenic
999230337 5:150057952-150057974 TCCAGAGAAGAGAGGGCACAAGG - Intronic
1000395680 5:160772514-160772536 TCCAGGGATGTGGGGGCATGAGG + Intronic
1000900128 5:166902582-166902604 TACAGGCAGGTGATGGGAGAAGG + Intergenic
1001040246 5:168329488-168329510 TCCTAGGAGGTGAGGGGAGAAGG + Intronic
1001740949 5:174052268-174052290 TTCAGGGAGGAGAGGGTAGTGGG + Intronic
1002001059 5:176196490-176196512 TCCTGGGAGGTGGGGGCGGGGGG - Intergenic
1002040840 5:176513017-176513039 GACAGGCAGGGGAGGGCAGAAGG - Intergenic
1002066522 5:176654710-176654732 TCCAGGCTGGTGGAGGCAGAGGG - Intronic
1002073610 5:176695328-176695350 AGAAGGGAGGGGAGGGCAGAGGG + Intergenic
1002253276 5:177942482-177942504 TCCTGGGAGGTGGGGGCGGGGGG + Intergenic
1002332503 5:178454445-178454467 TCCAGTGAGGTGATGCCAGGTGG + Intronic
1002453518 5:179332682-179332704 TGCAGAGAGGGGAGGGCAGAGGG + Intronic
1002561342 5:180084249-180084271 TCCAGGGAGGGGTGGGGAGCTGG + Intergenic
1003099406 6:3165472-3165494 TCCAGGGAGGTTAGGGGATGGGG + Intergenic
1003286038 6:4734645-4734667 TTCAGGAAGGGGAGGGCACAGGG + Intronic
1003838823 6:10099250-10099272 CCCAAGGAGGTGACGGCAGGTGG - Intronic
1003939692 6:11011892-11011914 TCCAGGAAGGTGGGGCCAGCGGG + Intronic
1003975165 6:11336078-11336100 CTGAGGGAGGTGAGGGCAGGAGG - Intronic
1004112418 6:12732071-12732093 TCCTGGGAGGTGGGGGAGGAGGG + Intronic
1004527639 6:16424253-16424275 TCAAGGGACGAGAGGGAAGAAGG + Intronic
1004916155 6:20334086-20334108 CCCAGTGTGGTGCGGGCAGAGGG - Intergenic
1005956170 6:30665062-30665084 TCCAGGGTGATGAGGTAAGAGGG - Exonic
1006167752 6:32075172-32075194 TAAAGGGGGGTGAGGGCAGAAGG - Intronic
1006285637 6:33092082-33092104 GCCAAGGCCGTGAGGGCAGAGGG + Intergenic
1006415559 6:33901767-33901789 GGGAGGGAGGTGAGGGCAGAAGG + Intergenic
1006981861 6:38153813-38153835 TCCAGGTGGGTGAGGGCAGGAGG + Exonic
1007463181 6:42032811-42032833 TACAGGAAGATGAGGGCAGCTGG - Intronic
1007619478 6:43203328-43203350 TCTAGGGAGCTCAGGGCAGGAGG + Intronic
1008020834 6:46575592-46575614 TCCAGTGAGGTGGGGACAGGGGG - Intronic
1008559866 6:52713349-52713371 TTCAGGGAGGTGTGGACACAAGG + Intergenic
1010779039 6:79922254-79922276 GAGAGGGAGGTGAGGGGAGAGGG - Intronic
1011410180 6:87059633-87059655 GCCAGGGAGGTGGGGGGAGGGGG + Intergenic
1011566955 6:88685517-88685539 TTCAGAGAGGAGAGGGGAGAAGG + Intronic
1012984962 6:105865944-105865966 GCCAGGGAGGTGAGGGCTGATGG - Intergenic
1013296660 6:108763829-108763851 TCCAGAGAGATGAAGGCAGAGGG - Intergenic
1015569268 6:134604641-134604663 CCCAGGTGTGTGAGGGCAGAGGG - Intergenic
1015879441 6:137856540-137856562 TCCAAGGAGCAGAGGACAGAGGG - Intergenic
1015920792 6:138264647-138264669 TCTAGAGAGGGGAGGGTAGAAGG - Intronic
1016380204 6:143469953-143469975 TTCTGGGGGGTGAGGGGAGATGG + Intronic
1016844363 6:148556522-148556544 TCCAGGGAGCAGTGGGCTGACGG - Intergenic
1016923388 6:149317630-149317652 GCGAGGGGGGTGGGGGCAGAGGG + Intronic
1017122822 6:151040080-151040102 TCAGGGGAGGTGAGGGGTGACGG + Intronic
1018030407 6:159837021-159837043 TGCGGGGAGGTGGGGGCAGGAGG - Intergenic
1018330912 6:162727271-162727293 GCCAGTGAGGTGAGGGGCGAAGG + Exonic
1018356253 6:163020944-163020966 TGGAGGGAGGTGCAGGCAGAGGG - Intronic
1018589937 6:165408742-165408764 GCCAGGGAGAAGAGGGAAGAAGG + Intronic
1018908703 6:168089663-168089685 CCCAGGGACCTGAGGACAGACGG - Intergenic
1018920677 6:168170380-168170402 TTCAGGGAGGTAAAGGAAGATGG - Intergenic
1019006352 6:168799900-168799922 TCTAGGGAGGTGTGGGCTGCGGG - Intergenic
1019220758 6:170470731-170470753 TTCAGGAAGGAGAGGGGAGAGGG + Intergenic
1019444515 7:1064430-1064452 ACATGGAAGGTGAGGGCAGAAGG + Intronic
1019584301 7:1789023-1789045 TCCAGGGAGATAAGGACGGATGG + Intergenic
1021277592 7:18673169-18673191 ACCTGGGAGGTTAGGGCAGGAGG + Intronic
1021345236 7:19519410-19519432 TGGAGGTAGATGAGGGCAGAAGG - Intergenic
1022210158 7:28200804-28200826 GTCAGGGTGGTGGGGGCAGAGGG + Intergenic
1022422078 7:30232777-30232799 TTGGGGGTGGTGAGGGCAGAAGG + Intergenic
1022924801 7:35046248-35046270 TCCAGGGAAGAGAGGGCATTGGG - Intergenic
1023268350 7:38432913-38432935 TCCCGGGGAGTGAGGCCAGATGG + Intronic
1023483599 7:40660856-40660878 GACAGAGAGGTGAGGGCACAAGG - Intronic
1023961082 7:44926905-44926927 TGCAGTGAGGTGATGCCAGAAGG + Intergenic
1023983166 7:45081262-45081284 GCCTGGGAGTAGAGGGCAGAGGG + Exonic
1024064207 7:45719104-45719126 CCCAGGGCTGTGAAGGCAGAGGG + Exonic
1025248950 7:57338825-57338847 TGCATGGAGGTGAGGGGGGAAGG + Intergenic
1025280166 7:57621170-57621192 TCCTGGGAAGAGAGGGCAGGAGG + Intergenic
1025304567 7:57844331-57844353 TCCTGGGAAGAGAGGGCAGGAGG - Intergenic
1026025153 7:66738621-66738643 ACTAGGGAGGTGGAGGCAGAAGG + Intronic
1026344443 7:69462134-69462156 TCCAGAGAGGGAAGGGAAGAAGG + Intergenic
1027164202 7:75823143-75823165 TGCAGGGGGGAGAGGGCAGTGGG + Intronic
1027265720 7:76494239-76494261 GCCAGAGAGGTGGGGGCAGGAGG + Intronic
1027317091 7:76992356-76992378 GCCAGAGAGGTGGGGGCAGGAGG + Intergenic
1028162298 7:87499184-87499206 TTCTGGGAGGTGAGGTGAGAAGG + Intergenic
1029433079 7:100544754-100544776 ATGAGAGAGGTGAGGGCAGAGGG + Intronic
1029664587 7:101986962-101986984 TCCAGGGAGGTGAGCGAGGCAGG - Intronic
1029822810 7:103160954-103160976 TCCAGGGAAGAGAGGGCATCAGG - Intergenic
1030156590 7:106461481-106461503 TCCAGAAAGGTGAGGGCGGGGGG + Intergenic
1030690136 7:112523967-112523989 TCCTGGGAGGTAGGGGCAAATGG + Intergenic
1030699183 7:112620075-112620097 TGCAGGCAGGTGAGGGCCGCTGG - Intergenic
1031464267 7:122089129-122089151 TGGAGGGTGGTGATGGCAGAGGG + Intronic
1031555945 7:123176309-123176331 TCCAGGGAGGTAATAGAAGAAGG + Intronic
1032443293 7:131958957-131958979 CCCAAGGAGGTGATGGCCGAGGG - Intergenic
1033653682 7:143360171-143360193 CACAGGGAGGTGAGGGCCGGCGG - Intronic
1033818866 7:145109270-145109292 TCTAGGAAAGTGAGGGGAGAGGG + Intergenic
1034436779 7:151066373-151066395 TCCCGGGAGGTGCGGGCACGGGG - Intronic
1034688527 7:152995320-152995342 CCCTGGGAGGTCAAGGCAGAAGG - Intergenic
1034693011 7:153029056-153029078 ACCAGGGAGGGGCGGGAAGAGGG - Intergenic
1035059793 7:156060522-156060544 TCCAGGCAGCAGCGGGCAGAGGG + Intergenic
1035180939 7:157089254-157089276 GCCAGGGAGCGGAGGACAGATGG + Intergenic
1035356804 7:158280565-158280587 TACCGGGTGGAGAGGGCAGATGG + Intronic
1035459589 7:159030788-159030810 ACCTGGGAGGTGAGGGCAGCGGG + Exonic
1035474998 7:159136971-159136993 TCAAGGGAGGGGAGTGGAGAAGG + Intronic
1035523101 8:290979-291001 GTCAGGGATGTGAGTGCAGAGGG + Intergenic
1035839561 8:2795707-2795729 TCCTGGGAGGGGAGGGCAGAGGG + Intergenic
1036132445 8:6128419-6128441 GGCAGGGATGTGAGGGCAGAGGG + Intergenic
1037035507 8:14162140-14162162 TCCAGCGAAGTAAAGGCAGATGG - Intronic
1037632293 8:20669186-20669208 TCCAGGCAGGTGAGGGGAGTAGG - Intergenic
1037662028 8:20936128-20936150 GAAAGGGAGGTGAGGACAGAAGG - Intergenic
1038418072 8:27412215-27412237 TCCAGGGAGGGAAGGGGAGCTGG - Intronic
1039612876 8:38932987-38933009 GCCAGGGAGGCCAGGACAGAGGG + Intronic
1039684898 8:39790518-39790540 TACAGGAAAGTAAGGGCAGAGGG + Intronic
1039758887 8:40552657-40552679 CCCAGGGAGATGAGTGGAGAAGG + Intronic
1040550607 8:48434507-48434529 TAAAGGGAGGTGAAGGCAGAGGG - Intergenic
1040798388 8:51313798-51313820 TCACGGGAGGAGAGTGCAGAAGG + Intergenic
1042224629 8:66505546-66505568 CCCAGGGAGGTGCGGGGAGCTGG - Intronic
1042959458 8:74288163-74288185 GCCATGGAGAAGAGGGCAGATGG + Intronic
1046538801 8:115551899-115551921 TGCATGGAGGTGAGAGCAGACGG - Intronic
1047002231 8:120584585-120584607 TCAAGGGAGGAAAGGGCTGAGGG + Intronic
1047203997 8:122789000-122789022 TCCGAGGAGGAGAGGGCGGAGGG - Intronic
1047314517 8:123720195-123720217 GCCAGGGAGCAGAGGGCAGAGGG + Intronic
1047428073 8:124765015-124765037 TCCAGGGAGGCCAAGGCAGGAGG - Intergenic
1047495376 8:125405146-125405168 TCCCGGGAGGAGCTGGCAGAGGG + Intergenic
1047525266 8:125627581-125627603 TGCAGGGAGGAGGGAGCAGACGG - Intergenic
1048002556 8:130391261-130391283 TCCAGGGATGGGAAGGGAGAGGG + Intronic
1048130978 8:131696988-131697010 TGAAGGGAGATGAGGGGAGATGG + Intergenic
1048172752 8:132123270-132123292 ACAAGGTAGGAGAGGGCAGAGGG + Exonic
1049196865 8:141320570-141320592 TCAAGCGAGATGTGGGCAGATGG - Intergenic
1049407836 8:142459553-142459575 TGCTGGGATGTGAGGGCAGCGGG - Intronic
1049475218 8:142794167-142794189 TCCAGGGAGGAGAGGCCACCAGG - Intergenic
1049758407 8:144320946-144320968 TCCAGGGAGGGCAGGGTGGAGGG - Intronic
1050138533 9:2493924-2493946 TTGAGGGGGGTGGGGGCAGAGGG + Intergenic
1050231108 9:3526439-3526461 TCCGGGGCGGGGCGGGCAGAGGG + Intergenic
1051240460 9:15050101-15050123 GCGGGGGAGGTGAGGGGAGAGGG + Intergenic
1051364285 9:16310149-16310171 ATCATGGAGGAGAGGGCAGAGGG + Intergenic
1051735113 9:20189924-20189946 TGCTGGGAGGGGAGGGGAGATGG + Intergenic
1052977348 9:34421125-34421147 AGCAGGGAGGTCAGGGCTGAGGG + Intronic
1053070221 9:35096659-35096681 TCCACCGAGGTGCCGGCAGATGG - Intergenic
1053272760 9:36761562-36761584 GCCAGGGAGGAGAGGGCGGGTGG + Intergenic
1054944818 9:70784487-70784509 TCCTGAGAGTTGAGGGGAGAGGG - Intronic
1055539100 9:77282687-77282709 CCCAGGGAGGTGAGCGCTGTGGG + Intronic
1055716843 9:79127322-79127344 CCCAGGCAGGTGTGGGAAGAGGG - Intergenic
1056013830 9:82360918-82360940 TCCAGGAAGCTCAGGGCACAAGG - Intergenic
1056521070 9:87402202-87402224 ACCAGGGAGGTCAAGGCAGGAGG + Intergenic
1056950319 9:91036312-91036334 CCCCAGGAGGGGAGGGCAGAAGG - Intergenic
1057081547 9:92177678-92177700 TCCTGGGTGTAGAGGGCAGAGGG - Intergenic
1057193534 9:93100725-93100747 TACCAGGAGGTGTGGGCAGAAGG - Intronic
1057311904 9:93948220-93948242 TCCAGGGAGATGGGGAGAGATGG + Intergenic
1057393716 9:94660823-94660845 TTCAGGGGGGTGAGGGGAGATGG + Intergenic
1057524488 9:95786582-95786604 TCCAGGGAGGGGAGTGGGGAGGG + Intergenic
1058603636 9:106697689-106697711 TCAAGGGATGGGAGGGAAGAAGG - Intergenic
1058820011 9:108721229-108721251 ACCAGGGAGGTGATGGTAGAAGG - Intergenic
1058935707 9:109767609-109767631 TTCAGGGAGAGGAGGCCAGAGGG - Intronic
1058951780 9:109910731-109910753 AGCAGGGCGGTGAGGGCAGAGGG + Intronic
1058951789 9:109910792-109910814 AGCAGGGCGGTGAGTGCAGAGGG + Intronic
1059436864 9:114282384-114282406 TCCAGGGAGGGGAGGGATGTGGG - Intronic
1059511826 9:114855427-114855449 TCCAGGGAGGGGAGAGGAGCTGG - Intergenic
1059681299 9:116589112-116589134 TCCAGGGGGGTGTGGTCACAGGG + Intronic
1059950164 9:119454069-119454091 CTCAGGGAGGTCATGGCAGAAGG + Intergenic
1060401613 9:123353039-123353061 CCCAGTGAGGTCAGGGCTGATGG + Intergenic
1060513627 9:124251894-124251916 TTCAGGGAGGTGCGGGGAGGTGG + Intergenic
1060783574 9:126431704-126431726 TCCAGGCAGCCGAGGGCAGCTGG + Intronic
1060794558 9:126505043-126505065 TCCTGGCAGGTGGGGGCAGCAGG + Exonic
1060973630 9:127752958-127752980 ACCAGGGTGGAGAGGGCAGGTGG + Intronic
1061293467 9:129665423-129665445 ATCTGGGAGGTGATGGCAGAGGG - Intergenic
1061392295 9:130324178-130324200 CCCAGGGGGCTGAGGGGAGACGG - Intronic
1062096450 9:134706314-134706336 TGCAGGAAGGGGAAGGCAGAGGG + Intronic
1062344584 9:136109046-136109068 GGCAGGGCGGGGAGGGCAGAGGG - Intergenic
1062344603 9:136109101-136109123 TGCAGGGCGGGGAGGGGAGAGGG - Intergenic
1062393917 9:136344998-136345020 TCCAGGGAGGTGAGGAGGGGTGG + Intronic
1062597301 9:137305061-137305083 CCCAGGGAGGACAGCGCAGAAGG + Intergenic
1203631543 Un_KI270750v1:75956-75978 TCCTGGGAAGAGAGGGCAGGAGG + Intergenic
1185472188 X:390638-390660 CCCAGGGAGGTGAGGAAGGAGGG + Intergenic
1186011764 X:5142407-5142429 TCCAGGGAAGTGAATGCAAAAGG - Intergenic
1186514669 X:10158351-10158373 TCCCGGGAGGTGAGGGTCGATGG - Exonic
1186541800 X:10408847-10408869 ACCAGGGTGCTGAGGGCTGACGG - Intergenic
1189283809 X:39837915-39837937 TCCAAGGAGGTGTGAGCAAATGG + Intergenic
1189427715 X:40916426-40916448 TTTAGGGAGGTGAGGGGAAATGG - Intergenic
1190031700 X:46979400-46979422 CTCAGGGAGGTGAGGAGAGAGGG + Intronic
1192047297 X:67689327-67689349 TTCAGAGAGTGGAGGGCAGAAGG + Intronic
1192358202 X:70423001-70423023 CTCAGGGAGGCGAGGGCTGAGGG - Intergenic
1192633063 X:72791808-72791830 GACAGGGAGGTGAGGTCAGAAGG - Intronic
1192648646 X:72928993-72929015 GACAGGGAGGTGAGGTCAGAAGG + Intronic
1193001505 X:76568087-76568109 CCCAGTGAGGTCAGTGCAGAAGG + Intergenic
1193317189 X:80077535-80077557 CCCAGGGAGGAGAAGCCAGATGG + Intergenic
1194125260 X:90008623-90008645 CCCAGGGTGATGAGGGCAGAGGG + Intergenic
1195748219 X:108139190-108139212 TTCAGGGAGGTGAGGTGGGATGG + Intronic
1197190452 X:123641680-123641702 TCCAGGGTGATGGAGGCAGAAGG - Intronic
1197330176 X:125144519-125144541 TGCAGAGAGGGGAGGACAGAGGG - Intergenic
1197819952 X:130532211-130532233 TCCAGGGAGGTCAAGGCTGCAGG - Intergenic
1198037978 X:132820601-132820623 TCCAGGGAGCTGTGGGCAAAAGG + Intronic
1198576822 X:138019577-138019599 TCCAGGGAAGGAAGGGTAGAGGG - Intergenic
1198796128 X:140397133-140397155 TCCAGAGAGGTGAGGGTTGCTGG - Intergenic
1199967063 X:152829500-152829522 TGCAGGGAGAAGAGGGCAAAAGG + Intronic
1200079929 X:153571284-153571306 TCCTGGGAGCTGAGGGCAGCAGG + Intronic
1200094387 X:153650373-153650395 GCAAGGGAGGGGAGGGCAGGAGG + Exonic
1201742256 Y:17336663-17336685 TGCAGGGAGCTGAAGGCTGATGG + Intergenic