ID: 1063960041

View in Genome Browser
Species Human (GRCh38)
Location 10:11299454-11299476
Sequence CCTTCCTGGGGGGGGTTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063960041_1063960054 -7 Left 1063960041 10:11299454-11299476 CCCCCCAACCCCCCCCAGGAAGG No data
Right 1063960054 10:11299470-11299492 AGGAAGGCCAGACTTCAGACAGG No data
1063960041_1063960057 16 Left 1063960041 10:11299454-11299476 CCCCCCAACCCCCCCCAGGAAGG No data
Right 1063960057 10:11299493-11299515 CTGTCAGTGACATGGTGACATGG No data
1063960041_1063960058 17 Left 1063960041 10:11299454-11299476 CCCCCCAACCCCCCCCAGGAAGG No data
Right 1063960058 10:11299494-11299516 TGTCAGTGACATGGTGACATGGG No data
1063960041_1063960056 8 Left 1063960041 10:11299454-11299476 CCCCCCAACCCCCCCCAGGAAGG No data
Right 1063960056 10:11299485-11299507 CAGACAGGCTGTCAGTGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063960041 Original CRISPR CCTTCCTGGGGGGGGTTGGG GGG (reversed) Intronic
No off target data available for this crispr