ID: 1063961138

View in Genome Browser
Species Human (GRCh38)
Location 10:11306208-11306230
Sequence CTCTGCTTGAAGAGGTGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063961134_1063961138 -1 Left 1063961134 10:11306186-11306208 CCTCCTGCTTGGATGGTGCAGCC 0: 1
1: 1
2: 1
3: 15
4: 157
Right 1063961138 10:11306208-11306230 CTCTGCTTGAAGAGGTGTTCTGG No data
1063961133_1063961138 2 Left 1063961133 10:11306183-11306205 CCTCCTCCTGCTTGGATGGTGCA 0: 2
1: 0
2: 1
3: 19
4: 244
Right 1063961138 10:11306208-11306230 CTCTGCTTGAAGAGGTGTTCTGG No data
1063961130_1063961138 20 Left 1063961130 10:11306165-11306187 CCTCTTGGCTTTGTTCTGCCTCC No data
Right 1063961138 10:11306208-11306230 CTCTGCTTGAAGAGGTGTTCTGG No data
1063961135_1063961138 -4 Left 1063961135 10:11306189-11306211 CCTGCTTGGATGGTGCAGCCTCT 0: 1
1: 0
2: 0
3: 11
4: 134
Right 1063961138 10:11306208-11306230 CTCTGCTTGAAGAGGTGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063961138 Original CRISPR CTCTGCTTGAAGAGGTGTTC TGG Intronic
No off target data available for this crispr