ID: 1063961507

View in Genome Browser
Species Human (GRCh38)
Location 10:11309878-11309900
Sequence GGGCTCTGTAACTTCCCCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063961507_1063961518 24 Left 1063961507 10:11309878-11309900 CCTTAGGGGAAGTTACAGAGCCC No data
Right 1063961518 10:11309925-11309947 CTGCTCTGGAGGTGGTGCAGGGG No data
1063961507_1063961510 10 Left 1063961507 10:11309878-11309900 CCTTAGGGGAAGTTACAGAGCCC No data
Right 1063961510 10:11309911-11309933 TGACCTGTCTCTCCCTGCTCTGG No data
1063961507_1063961513 16 Left 1063961507 10:11309878-11309900 CCTTAGGGGAAGTTACAGAGCCC No data
Right 1063961513 10:11309917-11309939 GTCTCTCCCTGCTCTGGAGGTGG No data
1063961507_1063961512 13 Left 1063961507 10:11309878-11309900 CCTTAGGGGAAGTTACAGAGCCC No data
Right 1063961512 10:11309914-11309936 CCTGTCTCTCCCTGCTCTGGAGG No data
1063961507_1063961517 23 Left 1063961507 10:11309878-11309900 CCTTAGGGGAAGTTACAGAGCCC No data
Right 1063961517 10:11309924-11309946 CCTGCTCTGGAGGTGGTGCAGGG No data
1063961507_1063961519 30 Left 1063961507 10:11309878-11309900 CCTTAGGGGAAGTTACAGAGCCC No data
Right 1063961519 10:11309931-11309953 TGGAGGTGGTGCAGGGGCAGTGG No data
1063961507_1063961515 22 Left 1063961507 10:11309878-11309900 CCTTAGGGGAAGTTACAGAGCCC No data
Right 1063961515 10:11309923-11309945 CCCTGCTCTGGAGGTGGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063961507 Original CRISPR GGGCTCTGTAACTTCCCCTA AGG (reversed) Intronic
No off target data available for this crispr