ID: 1063961508

View in Genome Browser
Species Human (GRCh38)
Location 10:11309898-11309920
Sequence AGACAGGTCACAAGAACAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 323}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063961508_1063961510 -10 Left 1063961508 10:11309898-11309920 CCCTTTGTTCTTGTGACCTGTCT 0: 1
1: 0
2: 1
3: 29
4: 323
Right 1063961510 10:11309911-11309933 TGACCTGTCTCTCCCTGCTCTGG No data
1063961508_1063961518 4 Left 1063961508 10:11309898-11309920 CCCTTTGTTCTTGTGACCTGTCT 0: 1
1: 0
2: 1
3: 29
4: 323
Right 1063961518 10:11309925-11309947 CTGCTCTGGAGGTGGTGCAGGGG No data
1063961508_1063961517 3 Left 1063961508 10:11309898-11309920 CCCTTTGTTCTTGTGACCTGTCT 0: 1
1: 0
2: 1
3: 29
4: 323
Right 1063961517 10:11309924-11309946 CCTGCTCTGGAGGTGGTGCAGGG No data
1063961508_1063961513 -4 Left 1063961508 10:11309898-11309920 CCCTTTGTTCTTGTGACCTGTCT 0: 1
1: 0
2: 1
3: 29
4: 323
Right 1063961513 10:11309917-11309939 GTCTCTCCCTGCTCTGGAGGTGG No data
1063961508_1063961512 -7 Left 1063961508 10:11309898-11309920 CCCTTTGTTCTTGTGACCTGTCT 0: 1
1: 0
2: 1
3: 29
4: 323
Right 1063961512 10:11309914-11309936 CCTGTCTCTCCCTGCTCTGGAGG No data
1063961508_1063961515 2 Left 1063961508 10:11309898-11309920 CCCTTTGTTCTTGTGACCTGTCT 0: 1
1: 0
2: 1
3: 29
4: 323
Right 1063961515 10:11309923-11309945 CCCTGCTCTGGAGGTGGTGCAGG No data
1063961508_1063961519 10 Left 1063961508 10:11309898-11309920 CCCTTTGTTCTTGTGACCTGTCT 0: 1
1: 0
2: 1
3: 29
4: 323
Right 1063961519 10:11309931-11309953 TGGAGGTGGTGCAGGGGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063961508 Original CRISPR AGACAGGTCACAAGAACAAA GGG (reversed) Intronic
900926795 1:5711077-5711099 AGACAGGTCTCCAGAAAAGATGG + Intergenic
904147711 1:28407646-28407668 AGATATGTCACATAAACAAAAGG - Intronic
905421851 1:37852293-37852315 AGAAAAGTAACATGAACAAATGG - Intronic
905821613 1:40996884-40996906 AGACAATTCACAAGAATTAATGG - Intronic
906943721 1:50277776-50277798 AGACAGGAAAGAAGAACAATAGG + Intergenic
907114097 1:51953497-51953519 AGACAATTCACAAAAACTAATGG + Intronic
909808624 1:79904381-79904403 ACACAGGAGACAAGAACAAATGG + Intergenic
909859836 1:80592074-80592096 AAATAGATCACTAGAACAAATGG - Intergenic
911241148 1:95468657-95468679 AGACAGGAAAGAAGAAAAAAAGG - Intergenic
911812690 1:102303540-102303562 AGACAGTACACAAGAACAGATGG + Intergenic
913534283 1:119756560-119756582 AAACAGGTACCAAGAAGAAAGGG + Intronic
916819897 1:168387915-168387937 AAGCAGGTCACAAGAACTAGTGG + Intergenic
918650362 1:186955260-186955282 TGACAGGTCATAAGATCAATAGG + Intronic
918881538 1:190130231-190130253 AGACAGGCCACAAGAAACAGAGG - Intronic
919260356 1:195185208-195185230 AGTCAGGTAACAATAAGAAAGGG - Intergenic
920393895 1:205630075-205630097 TGATAGGTAACAAGAATAAAAGG - Intronic
922823433 1:228500879-228500901 TCACAGATCACCAGAACAAAAGG + Intergenic
924121467 1:240803659-240803681 AGACAAGTCAAAAAAAAAAAAGG + Intronic
924617188 1:245621944-245621966 AAACAGAACACAAGAACAAAAGG - Intronic
1063501326 10:6557343-6557365 AGAAAGGTCTCTGGAACAAAAGG - Intronic
1063961508 10:11309898-11309920 AGACAGGTCACAAGAACAAAGGG - Intronic
1065317181 10:24474392-24474414 AGACAGATGAAAAGATCAAAAGG + Intronic
1066661614 10:37742136-37742158 AGAAAGTTCCCAGGAACAAAAGG - Intergenic
1067235423 10:44443192-44443214 AGACAGGTGCAAAGAATAAAAGG + Intergenic
1067248880 10:44570692-44570714 AGACATGTCACAAGATGACAGGG + Intergenic
1068172906 10:53419543-53419565 AGACATGTCATTAAAACAAAAGG - Intergenic
1069811550 10:71163743-71163765 AGAGAGGGAACAGGAACAAAGGG + Intergenic
1070810696 10:79296393-79296415 AGCCAGGTCACCTGAACAACGGG - Intronic
1071210205 10:83332801-83332823 AGATAGATCACAAGAAGAAAAGG - Intergenic
1072101676 10:92235120-92235142 AGACAGGAAAAAAGAACAAATGG + Intronic
1072120316 10:92400268-92400290 GGACATTTCACAAGAATAAAAGG + Intergenic
1072290534 10:93960836-93960858 AGACAGGTGGCAAGAACATTCGG - Intergenic
1072942487 10:99779231-99779253 AGACAGCATACAAGAACAAATGG - Intergenic
1075310356 10:121408462-121408484 AGACAGGACACATAATCAAAAGG + Intergenic
1076345395 10:129775567-129775589 AGACAGGTAAAAAAAAAAAAAGG + Intergenic
1078282239 11:9914204-9914226 AGACAGCACACAAGAATAGACGG + Intronic
1080435359 11:32235902-32235924 AGAGAGGTGACAAGACAAAAGGG - Intergenic
1080594624 11:33759974-33759996 AGCCAGGTCAGAAGACAAAAAGG + Intronic
1082261669 11:50080498-50080520 AGACAGGTCATGGAAACAAAGGG - Intergenic
1083229829 11:61309562-61309584 TGAAAGGCCAAAAGAACAAAAGG - Intronic
1085199384 11:74692572-74692594 ACCAAGGTCACAATAACAAATGG - Intergenic
1085647565 11:78236280-78236302 AGCAAGGTCACAAGATAAAAAGG - Intronic
1085791784 11:79502946-79502968 AACCAGGTCACAAGAAGAAAGGG - Intergenic
1086626513 11:88961769-88961791 AGACAGGCCACATGCATAAAAGG - Intronic
1087372799 11:97305804-97305826 AGACAGGCAACAAGAAACAATGG - Intergenic
1088123086 11:106392976-106392998 AGACAGGTTAATAGAAGAAAAGG + Intergenic
1088661191 11:112048113-112048135 AGAGAGGACACAAAAACAAATGG - Intronic
1089035615 11:115387125-115387147 AGGCTGGTCACAAGAATCAAGGG + Intronic
1089189854 11:116645810-116645832 AGACAGAGCCCAAGAAGAAAAGG - Intergenic
1089787067 11:120915394-120915416 AGACATCTCAGAAGAAAAAAAGG - Intronic
1091156242 11:133376949-133376971 AGAAAGGTCAAAAGAAGGAAGGG + Intronic
1093139678 12:15494300-15494322 AGGCTGGTCATAAGAAAAAAAGG + Intronic
1093248306 12:16767887-16767909 AAACAGCCCACAAAAACAAAAGG + Intergenic
1093697767 12:22181605-22181627 AGACAGTGCACAATAATAAATGG + Intronic
1094207811 12:27859228-27859250 AGAAAGGACAAAAGAAGAAATGG + Intergenic
1097451843 12:59745964-59745986 AGACAGGTCACATGATGAATGGG + Intronic
1097682202 12:62659364-62659386 AGACAGTTCAAAAGAGCAAAAGG + Intronic
1098026935 12:66213875-66213897 AAACAGTTCTCAAAAACAAATGG + Intronic
1099693158 12:85986788-85986810 ACACAGGTAAAAAGATCAAAAGG + Intronic
1101229885 12:102729721-102729743 AGACAGATTTCAAGAAGAAAAGG - Intergenic
1102834818 12:116045760-116045782 AGACAGGTTACAAGTAAAATGGG + Intronic
1103592430 12:122001824-122001846 TGACAGGTCAGTGGAACAAAGGG - Intronic
1104350910 12:128043097-128043119 AGCTGGGTCACAAGAGCAAAGGG + Intergenic
1106061620 13:26298405-26298427 AGAAAGGTAGAAAGAACAAAGGG - Intronic
1106085028 13:26534205-26534227 AACCTGGTTACAAGAACAAAAGG - Intergenic
1106175031 13:27322838-27322860 AGACAGATGACAAGAACAAGTGG + Intergenic
1107991439 13:45822029-45822051 ACACATGTCACAAGAGCAAAGGG - Intronic
1110214604 13:73011949-73011971 AGACAGCTTGCAAGAACAGATGG + Intronic
1111047476 13:82833427-82833449 AGACATGTCCCAAGGATAAATGG - Intergenic
1111625569 13:90780632-90780654 AGAAAAGTCACAAGTACATATGG - Intergenic
1113015895 13:105827944-105827966 AGACAGGGCACAGAATCAAAGGG - Intergenic
1115291884 14:31781485-31781507 AGACAGTTCTCAGGAAGAAATGG + Intronic
1116785007 14:49278213-49278235 ATACAGGTAACAAAAGCAAAAGG + Intergenic
1117168839 14:53069109-53069131 GGGTAGGTCACAAGAACACAGGG - Intronic
1118076111 14:62300880-62300902 AGACAGGATACATGAGCAAAAGG - Intergenic
1118982255 14:70726339-70726361 ACACATGTCCCAAGAACAAGGGG + Intronic
1119627640 14:76194103-76194125 ACACAGGTGACAACATCAAAGGG - Intronic
1122641708 14:103163864-103163886 AATCAGGTCACACAAACAAATGG - Intergenic
1123976644 15:25559976-25559998 AGAGAGGACACAGGAAGAAAGGG - Intergenic
1125140456 15:36400044-36400066 ACACAAGTCACAAGAAACAATGG - Intergenic
1125398454 15:39274966-39274988 ACACAAGTAACAAAAACAAAAGG + Intergenic
1125542797 15:40480239-40480261 AGTGAGGTCACCAGAACAATTGG - Intergenic
1128030588 15:64476623-64476645 AGACAGGAGAAAAGAACATAAGG - Intronic
1128485632 15:68084629-68084651 AGAAAGGACACCAGAAGAAAGGG - Intronic
1128506503 15:68276913-68276935 TGACAAGTGACAAGAACAGACGG - Intergenic
1129423155 15:75446160-75446182 TGACAGGTATCAAGAACAAAAGG + Intronic
1129601711 15:77002928-77002950 AGACATGTCAGGAGGACAAACGG + Intronic
1129762428 15:78137852-78137874 AGACAGGACACAAAAACCTAGGG - Intronic
1129939317 15:79479929-79479951 AGACAGTTCACAAGAAGATGTGG + Intergenic
1131804230 15:96105067-96105089 AAACTGGTCACAAGTACAGAAGG - Intergenic
1131964484 15:97827009-97827031 AGACAGGATGCAAGAACAGATGG - Intergenic
1138882056 16:61028535-61028557 AGAAAGATGACAAGAAAAAATGG - Intergenic
1142216441 16:88832181-88832203 AGACTGGTCATAGGGACAAAGGG + Intronic
1144006233 17:11102179-11102201 AGACAGTTGAGAAGAACAGATGG - Intergenic
1145003334 17:19320891-19320913 AGAGAGGTCACAAGGATCAAGGG - Intronic
1146564539 17:33901090-33901112 AGACAGGTCAGAAGCACAAAAGG - Intronic
1147636137 17:41965717-41965739 AGAAAGGTGCCAAGAAGAAAGGG + Intergenic
1148536360 17:48442357-48442379 AGGCAGGTCTGAAGAACAAGGGG - Intergenic
1149129927 17:53286996-53287018 AGACAGATCACAAGGTCAAGAGG - Intergenic
1149536328 17:57436432-57436454 AGCCAGAACACAAGTACAAAAGG - Intronic
1152515613 17:80822120-80822142 AGAGAGGTTGCAAGAAAAAAGGG - Intronic
1153720640 18:7898289-7898311 AGTCAGTTCCCTAGAACAAAGGG - Intronic
1154997505 18:21654720-21654742 AGTCATATCAGAAGAACAAAAGG + Intronic
1155437145 18:25825371-25825393 AGACAAGACAGAAGACCAAAGGG + Intergenic
1156352949 18:36316486-36316508 AGACAGCTCAAAAGGACAAGAGG - Intronic
1157178428 18:45473523-45473545 AGAGAGGACACAAAAACAAATGG - Intronic
1157393438 18:47322303-47322325 AGACAGCTCACAAGGACAAGAGG - Intergenic
1157494212 18:48143640-48143662 AGACAGGGCCCAAGGACAAGAGG - Intronic
1157812096 18:50704602-50704624 AGAACGCTCAGAAGAACAAAAGG - Intronic
1159101663 18:63965240-63965262 AGACAGGACACTAGAACAAGTGG + Intronic
1159959381 18:74543696-74543718 AGAGAGATAACAAGAAAAAAAGG + Intronic
1160105263 18:75968444-75968466 AGGCACGTAACAAAAACAAAAGG - Intergenic
1160554820 18:79718188-79718210 AGACAGGAGAGAAAAACAAAAGG - Intronic
1160585002 18:79909216-79909238 AGACAGATCCAAAGATCAAAAGG - Intronic
1160610964 18:80084716-80084738 AGACAAGCCAGAGGAACAAAGGG + Intronic
1160778202 19:866378-866400 AGCCAGGTCACCAGAACCACGGG + Intergenic
1161614617 19:5263172-5263194 GGAGAGGTCACCAGAACACAAGG + Intronic
1164052399 19:21594529-21594551 AGACAGGTTCCAGGAAGAAAAGG - Intergenic
1164172745 19:22739657-22739679 GGACAGGTCCCAGGAAGAAAAGG + Intergenic
1164533932 19:29070179-29070201 AGACAGCACACAAGAACAGAAGG + Intergenic
1164856185 19:31526047-31526069 AGACAGATAAAAAGAACAAATGG - Intergenic
1165263191 19:34638124-34638146 GGAAAGGTCAAAAGGACAAATGG + Intronic
1165369330 19:35394219-35394241 AGCCAGGTAACAAGAATAAAAGG - Intergenic
1165993916 19:39831729-39831751 AGAAAGGTCTCCAGACCAAAAGG - Intronic
1166273745 19:41736033-41736055 AGCCAAGTTACAGGAACAAAAGG + Intronic
925759736 2:7172835-7172857 ATACAGGTGAGAAGAACACAGGG - Intergenic
925848330 2:8054306-8054328 AGACAGGTCAGAGGATCTAAAGG - Intergenic
927260797 2:21087615-21087637 AAACACATCACAAAAACAAAAGG - Intergenic
927291025 2:21405175-21405197 ATACAGGTCTCAGGATCAAAGGG + Intergenic
927378667 2:22451041-22451063 ACACAGTTCTCTAGAACAAAGGG - Intergenic
928388873 2:30893511-30893533 AAACATGTCACAAGGATAAAAGG + Intergenic
928625341 2:33134087-33134109 AGCCAGGTCACAGGGATAAATGG - Intronic
929036965 2:37702863-37702885 TCACAGGTGACACGAACAAATGG - Intronic
932031704 2:68193559-68193581 AGTCAGCTTTCAAGAACAAATGG + Intronic
932077915 2:68682521-68682543 ACAAAGGACACAAGAAGAAAAGG + Intronic
932179045 2:69629185-69629207 AGACAGGTCACAAATAGGAAGGG - Intronic
932286372 2:70535748-70535770 AGACACTTCACAAGAAAATAAGG + Intronic
932941057 2:76166038-76166060 AGACACTTCATAAGGACAAAAGG - Intergenic
932963937 2:76448302-76448324 AGGAAGGTCACAAGAAAAAGAGG - Intergenic
933301022 2:80541127-80541149 AGACAAGCCAAAAGAAAAAAGGG + Intronic
933776665 2:85775222-85775244 AGACAGGACACAAAGAGAAAGGG - Intronic
933843680 2:86308095-86308117 GGTCAGATCACTAGAACAAAAGG + Intronic
936241247 2:110790354-110790376 GGACAGGTCACAGGGACCAAAGG - Intronic
937651935 2:124328890-124328912 AGACAGGTTAAAAGGAGAAAAGG + Intronic
938371736 2:130773031-130773053 AGACAAGTTACAAGAACAGATGG + Intergenic
938610780 2:132945359-132945381 AGACAGGACAGATGAACAAGGGG + Intronic
939253404 2:139712640-139712662 AGAGATGTCAGAAAAACAAATGG - Intergenic
940071289 2:149690963-149690985 TGACAGCACACAAGGACAAAGGG - Intergenic
940546859 2:155100118-155100140 GCACAGCTCACAACAACAAAAGG + Intergenic
941287436 2:163631559-163631581 AGACAGGTTCCTAGAAGAAAGGG - Intronic
942023233 2:171887686-171887708 AGAGAGGTTAAAAGAAAAAAGGG + Intronic
942133659 2:172904882-172904904 AGAGAGGTGACAAGAACAGATGG - Intronic
942229643 2:173848405-173848427 AGACATGTCACATGGAGAAAGGG + Intergenic
943540060 2:189202431-189202453 AGAGAGGTGAGAAGAACAAGTGG + Intergenic
943658112 2:190530352-190530374 AGAGAGGTGATAAGAAAAAAGGG - Intronic
943899167 2:193410065-193410087 AGACAGAACACTAAAACAAAAGG + Intergenic
944465949 2:199999681-199999703 ATGCAGGTCACAGGACCAAATGG + Intronic
944880043 2:204003531-204003553 AGGAAAGTCACAAGAAGAAATGG + Intergenic
945309321 2:208292660-208292682 AAACAGGATACATGAACAAAAGG - Intronic
946799233 2:223392570-223392592 AGATATGTCAAAAGGACAAAAGG - Intergenic
946913564 2:224490778-224490800 AGACAGCTCATTTGAACAAAAGG - Intronic
948085667 2:235244777-235244799 AGACAAGTGACAACAAGAAACGG + Intergenic
948550800 2:238772008-238772030 AGAAGGGTCACAGCAACAAACGG + Intergenic
948647804 2:239419097-239419119 ATTCAGGGCACAAGACCAAATGG + Intergenic
1169290714 20:4349075-4349097 AGACAGCATACAAGAACAGATGG - Intergenic
1171180865 20:23089284-23089306 AGGCAGGTCACAAGGACAGGGGG - Intergenic
1172457736 20:35091275-35091297 AGTCAGGTCTTAAGAACACAAGG + Intronic
1173055605 20:39609421-39609443 AGAGAGGGCATAGGAACAAATGG + Intergenic
1173349641 20:42233126-42233148 AGAAAGGGGACAAGAACAGAGGG - Intronic
1174949612 20:55029581-55029603 TTACAAGTCACAAGCACAAAAGG - Intergenic
1176943735 21:14954252-14954274 TGGCAGGCCATAAGAACAAAAGG + Intergenic
1177149593 21:17441822-17441844 TGAAAGGTCTCTAGAACAAAGGG + Exonic
1177480560 21:21681634-21681656 AGACAGGTCTCATAAGCAAATGG - Intergenic
1177844621 21:26274299-26274321 AAACATGTCAAAAAAACAAATGG + Intergenic
1177954940 21:27585783-27585805 AGACTAGTCACAAGAAAAACAGG + Intergenic
1178951180 21:36987067-36987089 AGACAGGTCAGAAGGACACAGGG - Intronic
1178962412 21:37077760-37077782 AGACAACTCATCAGAACAAAGGG - Intronic
1179019780 21:37628273-37628295 AGCCATGTCTAAAGAACAAAAGG + Intronic
1179083935 21:38200330-38200352 AGACAGGTCACCAAGACAGAAGG - Intronic
1179239127 21:39573322-39573344 TAAGCGGTCACAAGAACAAAAGG - Intronic
1179392308 21:41004894-41004916 AGGGAGGTCACGAGAACACAGGG + Intergenic
1180878575 22:19187457-19187479 AGCCAGGTCTCAGGAACAAGAGG + Intronic
1181264571 22:21623497-21623519 AGAGAAGCAACAAGAACAAATGG - Exonic
1181817888 22:25452882-25452904 ACACAGGTCGCAAAAAGAAAAGG - Intergenic
949584521 3:5424874-5424896 AGACAAGTTACATGATCAAATGG - Intergenic
951518101 3:23584356-23584378 AGACAGGGAACAAGACTAAAAGG - Intronic
951658205 3:25032769-25032791 AGGCAAGTTACTAGAACAAAGGG - Intergenic
952417137 3:33099242-33099264 AAACAGTTCACAAAAAAAAATGG + Intergenic
952917572 3:38260654-38260676 AGACAGCATACAAGAACAGATGG - Intergenic
953865391 3:46579156-46579178 AGAGTGATCAAAAGAACAAAAGG - Intronic
954102640 3:48388483-48388505 AGACATTACACAAAAACAAAAGG - Intronic
955630843 3:60973073-60973095 TGCCAGGAAACAAGAACAAATGG - Intronic
956096692 3:65723713-65723735 AGAAAGTTAACAACAACAAATGG + Intronic
956765200 3:72478867-72478889 AGGCAGCTCAGAAGACCAAATGG + Intergenic
957104004 3:75862984-75863006 AGGCATGTCAAAAGAAGAAAAGG + Intergenic
957383664 3:79467689-79467711 AATCAGGTCACACGGACAAATGG - Intronic
957724008 3:84041304-84041326 GTACAGGTCACAAGGATAAATGG + Intergenic
960361085 3:116712444-116712466 AGAGAGGTGCCAAGAACAGAGGG - Intronic
960844541 3:121993985-121994007 GGACAGGACAATAGAACAAATGG + Intronic
961733352 3:128984027-128984049 AGAGAGCTCTCAAGAACAACAGG + Intronic
961932404 3:130547731-130547753 AGACAGCACACAATAACAGATGG - Intergenic
962064088 3:131961012-131961034 AGAGATGTCACAAGAAAAAGAGG + Intronic
962149544 3:132878394-132878416 CGACATGTCACAAGAGCAAATGG - Intergenic
963382803 3:144553419-144553441 AAACAGGTAACACAAACAAAGGG - Intergenic
963727471 3:148938266-148938288 AGAAAGGTCCCAAGCACAACAGG + Intergenic
964106884 3:153049200-153049222 AGAGAATTCACAAGAACAGAGGG - Intergenic
964229935 3:154454082-154454104 AGACTGGAAACAAGAACACAGGG - Intergenic
964387648 3:156165758-156165780 GGAGAGCTCAGAAGAACAAAAGG - Intronic
965428785 3:168561198-168561220 AGAAAGGTTGAAAGAACAAATGG - Intergenic
965858272 3:173115481-173115503 AGACTGTTCAAAAGAACAGAGGG + Intronic
968022306 3:195403984-195404006 TTAAAGGTCAGAAGAACAAAAGG + Intronic
968439564 4:616277-616299 AGACAGCACACAGGAACAGATGG - Intergenic
968682534 4:1931063-1931085 AGAGAGGACACAAGAAGGAAGGG + Intronic
970518275 4:16857196-16857218 AGACATGTCAAAGAAACAAAGGG - Intronic
970563251 4:17304121-17304143 AGGCAGCATACAAGAACAAATGG + Intergenic
971229411 4:24788230-24788252 GGACAGTTCACAATGACAAAAGG - Intergenic
971260103 4:25048826-25048848 TCACAGGTGACAAAAACAAATGG - Intergenic
972905027 4:43735494-43735516 ATACAGGTAACAAAAAAAAATGG + Intergenic
974593558 4:63987117-63987139 AAACTGGACACTAGAACAAATGG + Intergenic
974815833 4:67002280-67002302 AATCAGGTGACACGAACAAATGG - Intergenic
975539773 4:75496313-75496335 GGACAGGTTAGAAGAACTAAGGG + Intronic
977462391 4:97341354-97341376 TAACAGGTGACAAAAACAAATGG + Intronic
978112651 4:104981003-104981025 AGACAGGAGAGAAGAAAAAAAGG + Intergenic
979705866 4:123719872-123719894 AGAAAGGTGACACAAACAAATGG + Intergenic
979840177 4:125429296-125429318 AGACAGAGCACAAGACCTAATGG + Intronic
981767179 4:148264214-148264236 AGACAGGTCACAAAAATAGATGG + Intronic
981957091 4:150490788-150490810 AAAGAGGTCACTAGAACAGAAGG + Intronic
982394020 4:154896469-154896491 AGACAGGATACACAAACAAATGG + Intergenic
982712558 4:158771351-158771373 AGCCAGGTGAAAAGAGCAAAAGG - Intronic
982988496 4:162240683-162240705 ATACAGGTCATGAGAACAGATGG + Intergenic
983395107 4:167184048-167184070 ATACATTTAACAAGAACAAATGG - Intronic
983556112 4:169060495-169060517 AGACAACTCAGAAGAACACACGG + Intergenic
983563713 4:169127717-169127739 GGACAGGTCACAAGAGAACATGG - Intronic
983906226 4:173184840-173184862 AGACAGCTGACAAGAAGTAATGG - Intronic
986511220 5:8508302-8508324 AAACAAGTAAGAAGAACAAAAGG + Intergenic
986944375 5:12997891-12997913 AGACTGGACACAAGAACAGTTGG + Intergenic
987149360 5:15023208-15023230 AGACAGGTGACAAGGACATCTGG - Intergenic
988557655 5:32251559-32251581 AGTCATGTTACAAGAAGAAATGG + Intronic
989030867 5:37116966-37116988 ACAGAGGCCACAAGAACAAGGGG + Intronic
990138658 5:52678299-52678321 AGAGAGGACACAAAAATAAATGG - Intergenic
992239700 5:74754790-74754812 AGACAGGTCATCAAGACAAAAGG + Intronic
993827051 5:92702940-92702962 AGGCAGGGCACAAGAATAGAAGG + Intergenic
993877126 5:93320805-93320827 AGACAGTTCACATGAAATAAAGG + Intergenic
995888216 5:116919800-116919822 AGACAGGTCCCTAGAACGAATGG - Intergenic
996575427 5:124972663-124972685 AGACAGGCCAAAAGACCAATTGG - Intergenic
996888108 5:128383506-128383528 AGATATGTTACAAGAAGAAAAGG + Intronic
997541230 5:134664631-134664653 AGACAAGTCAAAGGAACAAAGGG - Intronic
999115398 5:149158809-149158831 AGACACATCACATGTACAAATGG + Intronic
999501230 5:152148467-152148489 AGAGAGGTCAGAAGGAGAAAAGG - Intergenic
999875553 5:155801850-155801872 AGACAAGTAACAGGAACAAAAGG - Intergenic
1000283918 5:159809954-159809976 AGACATTTCAAAATAACAAAGGG + Intergenic
1000535667 5:162475345-162475367 AGTCAGGCAACAAGAAAAAATGG + Intergenic
1001431628 5:171667090-171667112 AGTCAAGTGACAAGATCAAATGG + Intergenic
1003167083 6:3689282-3689304 AGGCAGGAAAAAAGAACAAAAGG - Intergenic
1003626179 6:7743617-7743639 AGCCAGGTCTCAAGCACCAAGGG - Intronic
1003653828 6:7987195-7987217 AGACAGGTGGCAAGAACATTCGG + Intronic
1004781585 6:18914318-18914340 AGAAAGATCTAAAGAACAAAAGG - Intergenic
1006251811 6:32793728-32793750 AGAGAGGTCACAAGAGCTCATGG - Intergenic
1006283888 6:33078410-33078432 AAACAGGGCACAAGACCAAAGGG + Intronic
1007599369 6:43072250-43072272 AGACAGGTCAGAAGCCCAGAGGG + Exonic
1008192112 6:48472730-48472752 AGACCAGTCACTAAAACAAAAGG + Intergenic
1008457042 6:51723197-51723219 ACAGAGGTCCCAAGAGCAAAAGG - Intronic
1009272696 6:61634693-61634715 ATAAAGGTCTCAAGAAAAAATGG + Intergenic
1009447106 6:63755778-63755800 AGAGAGGACACACAAACAAATGG - Intronic
1010027416 6:71235862-71235884 AAACAGGTTACAACAAGAAATGG - Intergenic
1011910417 6:92429475-92429497 AGACAGGTCTCTAGGTCAAAAGG + Intergenic
1013004632 6:106060847-106060869 ACAGAGGTAACAAGAACTAATGG + Intergenic
1013153111 6:107465666-107465688 GGACAGGTCAGAGGCACAAAGGG + Intergenic
1013217930 6:108047151-108047173 AGACGGCACAGAAGAACAAATGG + Intronic
1014605711 6:123471869-123471891 AGACAGGGTACAAGGATAAATGG - Intronic
1015655007 6:135508058-135508080 ATACAGGGCTCAAAAACAAAGGG - Intergenic
1017164756 6:151397346-151397368 AGACAAGTAACAAGCAAAAAGGG - Intergenic
1017336855 6:153271462-153271484 AGACAGCACACAAGAGCAGATGG - Intergenic
1017830484 6:158123712-158123734 AGACTGGTAACAGGATCAAAGGG + Intronic
1018483809 6:164219117-164219139 AGACAGAGCATAAGAACACATGG + Intergenic
1019001457 6:168756608-168756630 AGACTGGTTCCAAGAACATAAGG + Intergenic
1019045734 6:169143836-169143858 AGACAGGAGACAAGAAAATATGG - Intergenic
1020143929 7:5628221-5628243 AGACAGGACTCAAGGGCAAATGG - Intronic
1021124115 7:16830652-16830674 AGACACGTCAAAAAAAGAAAAGG + Intronic
1021198971 7:17705745-17705767 AGACAGGTCTTAAGCAGAAACGG - Intergenic
1021801727 7:24314011-24314033 AGACAGGTGCCAGGTACAAATGG - Intergenic
1022423597 7:30246650-30246672 TGACAGGTCACCAGAAAACAGGG - Intergenic
1022776018 7:33528300-33528322 AGACCTGTTAAAAGAACAAATGG - Intronic
1023049513 7:36238899-36238921 TAACAAGTCGCAAGAACAAAAGG - Intronic
1024431557 7:49294222-49294244 ATACAGGTGACAACAAGAAAAGG - Intergenic
1024516164 7:50259781-50259803 AGACACTTCACAATGACAAAAGG + Intergenic
1025784812 7:64634646-64634668 GGACAGGTCTCATGAAGAAAAGG - Intergenic
1026705114 7:72683844-72683866 ACACAGCACACAAGAACAGATGG + Intronic
1027754324 7:82192518-82192540 AGACAGGTAAAAAGAATCAAGGG + Intronic
1028852712 7:95554151-95554173 ACAGAGGTCACAACAACAACTGG + Intergenic
1029235459 7:99112742-99112764 AGCCAGGTCTAAAGAACTAATGG + Intronic
1030361936 7:108604493-108604515 ACACATCTCACAAGAACAACAGG + Intergenic
1030464919 7:109889089-109889111 AGAGAGGTCAGAGGAAGAAATGG - Intergenic
1030592366 7:111497588-111497610 AGACAGGACGGAAGAAAAAAGGG + Intronic
1031139087 7:117921459-117921481 AGACAGGTCATCAAGACAAAAGG + Intergenic
1032282355 7:130514634-130514656 AGATAGGTAACAAGGAGAAAAGG + Intronic
1032832756 7:135645007-135645029 ATAAAGGATACAAGAACAAAGGG - Exonic
1033204612 7:139407380-139407402 ATACAGATCAAAAGAACAAGAGG - Intronic
1034221882 7:149452954-149452976 AGACAGGTCAAAAGCCCTAATGG + Intronic
1038604006 8:28979951-28979973 AGAAAGGACACAAAAATAAAGGG - Intronic
1040329242 8:46377536-46377558 AGAGAAGTCACGAGAACACAGGG + Intergenic
1040818147 8:51530318-51530340 AGACAGATGTCATGAACAAATGG - Intronic
1041092911 8:54319283-54319305 AGACAGCATACAAGAACAGATGG + Intergenic
1042438363 8:68794711-68794733 AGACAGATCACTTGAACCAAGGG - Intronic
1043716097 8:83488916-83488938 AAACAGGTGAAAAGAACTAAGGG + Intergenic
1043994902 8:86801142-86801164 AGAGAGGTCTCCAGAAGAAATGG + Intergenic
1044423807 8:92028265-92028287 AGACAGTTCAATAGAGCAAATGG + Intronic
1044616694 8:94149715-94149737 AGCCAGATCACAAGAAGCAATGG + Intronic
1045269070 8:100646316-100646338 AGACAGGTCACGGGAAGAAGAGG + Intronic
1045594841 8:103641757-103641779 AGAGAGGACACAAGAAAAAGGGG - Intronic
1046130022 8:109955266-109955288 AGATAGCACACAAGAACAGATGG - Intergenic
1046502196 8:115093127-115093149 AGACAGCATGCAAGAACAAATGG - Intergenic
1046622191 8:116539820-116539842 AGACAGGATATTAGAACAAATGG + Intergenic
1046753689 8:117951568-117951590 AGACAAATAACAAGAACCAAAGG + Intronic
1047044007 8:121031456-121031478 AAACAGGACTCAACAACAAAAGG + Intergenic
1048468781 8:134688864-134688886 GGACACGTCTCATGAACAAATGG - Intronic
1048746547 8:137620852-137620874 AGCCAGCTCACTACAACAAAGGG - Intergenic
1050391836 9:5152463-5152485 AGAAAAATCACAAGAAAAAATGG + Intronic
1050440804 9:5661481-5661503 TGACAGATGACACGAACAAATGG - Intronic
1050629459 9:7543191-7543213 AGTGAGGGCACAAGAGCAAATGG - Intergenic
1051032853 9:12703814-12703836 AGACAGGTCATAAATAAAAATGG - Intronic
1051112780 9:13658167-13658189 AGGCAATTCACAATAACAAAAGG + Intergenic
1052682805 9:31715945-31715967 AGACAGGACACAATAAGAAGTGG + Intergenic
1054806349 9:69399442-69399464 AAACAGCTAACAAGAAAAAAGGG - Intergenic
1058258185 9:102796087-102796109 AGACAGGAAAGAAGGACAAAAGG - Intergenic
1058564372 9:106266017-106266039 AGACAGGTCTCAAAAACCATGGG + Intergenic
1203653009 Un_KI270751v1:146502-146524 AGGCATGTCAAAAGAAGAAAAGG + Intergenic
1185744453 X:2560926-2560948 AGACATGTCATAAAAACACAGGG + Intergenic
1186337472 X:8606044-8606066 AAACAGAAAACAAGAACAAATGG + Intronic
1187352215 X:18530554-18530576 AGACAGCACGCAAGAACAGATGG - Intronic
1187746732 X:22417559-22417581 AGACAGAAAAAAAGAACAAAGGG - Intergenic
1188920164 X:35964870-35964892 AAACAGGTCAAAAGAATTAAAGG - Intronic
1190147433 X:47907830-47907852 AGAAATGTCACAAGAAAAAAAGG + Intronic
1192490865 X:71576435-71576457 AGAGAGGTCACAAGCAAAAGAGG - Intergenic
1193186576 X:78520330-78520352 TGAAAGGTCAGAAGAACAAGTGG + Intergenic
1193516636 X:82473736-82473758 AGAAAGGACACAAAAACAAATGG - Intergenic
1194110017 X:89822284-89822306 TGACAGATGACAAAAACAAATGG - Intergenic
1194385033 X:93242315-93242337 AAACAGATGACACGAACAAATGG + Intergenic
1194578246 X:95639932-95639954 AGCTAGGACACAAGAACACAAGG + Intergenic
1195374059 X:104209013-104209035 AGGCAGGTAACAAGAAAAATAGG + Intergenic
1196657746 X:118237468-118237490 AGCCAAGTCATATGAACAAAGGG - Intergenic
1196911017 X:120484594-120484616 AGACAATTCAAAAGAATAAAAGG - Intergenic
1197030978 X:121815627-121815649 AGACAGCATACAAGAACAGATGG - Intergenic
1197071792 X:122307950-122307972 ACACAGTTAAAAAGAACAAATGG - Intergenic
1197085266 X:122466355-122466377 ACATAGGTCAAAAGAACACAAGG - Intergenic
1197674714 X:129316713-129316735 AGACAGTTCTGAAGAACAATTGG - Intergenic
1199920104 X:152392161-152392183 ACACAGAGCACAGGAACAAATGG + Intronic
1200011533 X:153124267-153124289 TGACAGGTCACCAGCACACACGG - Intergenic
1200028068 X:153275652-153275674 TGACAGGTCACCAGCACACACGG + Intergenic
1200462679 Y:3477022-3477044 TGACAGATGACAAAAACAAATGG - Intergenic
1200894736 Y:8363104-8363126 AGACAGGGAAGAAGAAAAAAAGG + Intergenic
1202260524 Y:22965705-22965727 AGACAGGTTTGAAGAAAAAAAGG - Intergenic
1202413511 Y:24599446-24599468 AGACAGGTTTGAAGAAAAAAAGG - Intergenic
1202457271 Y:25070622-25070644 AGACAGGTTTGAAGAAAAAAAGG + Intergenic