ID: 1063961509

View in Genome Browser
Species Human (GRCh38)
Location 10:11309899-11309921
Sequence GAGACAGGTCACAAGAACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 250}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063961509_1063961519 9 Left 1063961509 10:11309899-11309921 CCTTTGTTCTTGTGACCTGTCTC 0: 1
1: 0
2: 0
3: 26
4: 250
Right 1063961519 10:11309931-11309953 TGGAGGTGGTGCAGGGGCAGTGG No data
1063961509_1063961512 -8 Left 1063961509 10:11309899-11309921 CCTTTGTTCTTGTGACCTGTCTC 0: 1
1: 0
2: 0
3: 26
4: 250
Right 1063961512 10:11309914-11309936 CCTGTCTCTCCCTGCTCTGGAGG No data
1063961509_1063961515 1 Left 1063961509 10:11309899-11309921 CCTTTGTTCTTGTGACCTGTCTC 0: 1
1: 0
2: 0
3: 26
4: 250
Right 1063961515 10:11309923-11309945 CCCTGCTCTGGAGGTGGTGCAGG No data
1063961509_1063961513 -5 Left 1063961509 10:11309899-11309921 CCTTTGTTCTTGTGACCTGTCTC 0: 1
1: 0
2: 0
3: 26
4: 250
Right 1063961513 10:11309917-11309939 GTCTCTCCCTGCTCTGGAGGTGG No data
1063961509_1063961518 3 Left 1063961509 10:11309899-11309921 CCTTTGTTCTTGTGACCTGTCTC 0: 1
1: 0
2: 0
3: 26
4: 250
Right 1063961518 10:11309925-11309947 CTGCTCTGGAGGTGGTGCAGGGG No data
1063961509_1063961517 2 Left 1063961509 10:11309899-11309921 CCTTTGTTCTTGTGACCTGTCTC 0: 1
1: 0
2: 0
3: 26
4: 250
Right 1063961517 10:11309924-11309946 CCTGCTCTGGAGGTGGTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063961509 Original CRISPR GAGACAGGTCACAAGAACAA AGG (reversed) Intronic
901078568 1:6570867-6570889 GAGACAGCTGAGAAGGACAAAGG - Intronic
903437587 1:23363064-23363086 GAGATAGGTCAGAAAGACAATGG - Exonic
905637875 1:39567392-39567414 GAGACAGGCCCCAAGACAAATGG + Intronic
905714838 1:40140037-40140059 GAGAAATGTCAAAAGAACACAGG - Intergenic
907539874 1:55205090-55205112 GCTACAGGTCACAGGAACAGAGG + Intronic
907592246 1:55686352-55686374 GAGAAAGGTAATAAAAACAATGG - Intergenic
908174162 1:61537993-61538015 CAGACAGTTTACTAGAACAAAGG - Intergenic
908775890 1:67639597-67639619 GAGAAAGGCCACATGGACAAAGG + Intergenic
909199584 1:72673486-72673508 CAGATAAGTCACAAGATCAAAGG + Intergenic
909235233 1:73144556-73144578 GGGCCAGGTCACCAGAAAAAGGG - Intergenic
910216765 1:84851315-84851337 GGGTCTGGTCACAAGAACAAAGG - Intronic
911438533 1:97895259-97895281 GACACTGCTCACAAGACCAAGGG + Intronic
911457685 1:98147582-98147604 GAAAGAGGTCACAAGAAAAGGGG - Intergenic
911588294 1:99716448-99716470 GAGAGAGAGCACAAGAGCAAAGG + Intronic
912041722 1:105398615-105398637 GTAAAAGGTCACAGGAACAAAGG + Intergenic
915207239 1:154279180-154279202 GAGGTATATCACAAGAACAAAGG + Intergenic
916512603 1:165486000-165486022 GAGACACGTCAGAAGCAGAATGG + Intergenic
918037047 1:180883778-180883800 GAGGAAGGTAACAAGAACAATGG - Intronic
918601469 1:186367961-186367983 GAGCCAATTTACAAGAACAAAGG - Exonic
919143766 1:193607243-193607265 GAGACATGTCAAAGGAACACAGG + Intergenic
919713888 1:200755028-200755050 GAGCCATGTCAAAAGAACACAGG - Intronic
920696216 1:208183105-208183127 GGGAGAGGTCAGAAGAACAAAGG + Intronic
920838013 1:209529836-209529858 GAAGCAGTTCCCAAGAACAAGGG - Intergenic
922950683 1:229556604-229556626 GTGAGGGGTCACAGGAACAATGG + Intronic
923471228 1:234292718-234292740 CTGACAGTTCATAAGAACAAGGG - Intronic
1063961509 10:11309899-11309921 GAGACAGGTCACAAGAACAAAGG - Intronic
1064596115 10:16947039-16947061 TAGACAGGACCCAAGAACCATGG + Intronic
1064626049 10:17262610-17262632 GAGACAGGACACAGTAGCAAGGG + Intergenic
1065122621 10:22543882-22543904 GGGACAGGTGACAAGATCCAAGG + Intronic
1065659472 10:27990796-27990818 AAGTCAGGTCACCAGAGCAATGG - Intronic
1068020088 10:51570639-51570661 TCGACAGGTCAAAATAACAATGG - Intronic
1069811549 10:71163742-71163764 GAGAGAGGGAACAGGAACAAAGG + Intergenic
1069831434 10:71284579-71284601 GAGACAGGAGACAAGAGGAATGG + Intronic
1070535399 10:77373657-77373679 CAGACAGGTGAAAAGAAGAATGG - Intronic
1070789290 10:79180091-79180113 GAGACAGGTGGAGAGAACAAGGG + Intronic
1070810697 10:79296394-79296416 TAGCCAGGTCACCTGAACAACGG - Intronic
1073517102 10:104086374-104086396 GACACAGGACACAGGAACAGAGG - Intergenic
1074024641 10:109621666-109621688 AAGGGAGGCCACAAGAACAACGG + Intergenic
1078710364 11:13785150-13785172 AAGAAAGGATACAAGAACAAAGG - Intergenic
1080638614 11:34145029-34145051 GAGACAGGTCACACTGACAGTGG - Intronic
1082261670 11:50080499-50080521 GAGACAGGTCATGGAAACAAAGG - Intergenic
1084635040 11:70386337-70386359 ATGACAGGTCACATGAAGAAAGG - Intergenic
1085791785 11:79502947-79502969 AAACCAGGTCACAAGAAGAAAGG - Intergenic
1087938568 11:104064686-104064708 AAGACAGGTCTCTGGAACAATGG + Intronic
1090494449 11:127196217-127196239 GAGAGAGTACACAAGAAGAAAGG - Intergenic
1091928468 12:4375030-4375052 GAGCCAGGTGCCAAGAACCAGGG + Intronic
1093271962 12:17074401-17074423 GAGACAGGTGAGAAGAAACAGGG - Intergenic
1093647556 12:21604950-21604972 GAGTCTGGTCAAAAGGACAAGGG - Intergenic
1094387284 12:29909079-29909101 GGGAGATGTCACAAGAATAAAGG - Intergenic
1095512587 12:42969305-42969327 GAGGCAGGTCACAGGAAAGATGG + Intergenic
1096070948 12:48775272-48775294 GATACAGGGCAGAAGGACAAGGG - Intronic
1097451842 12:59745963-59745985 AAGACAGGTCACATGATGAATGG + Intronic
1098142440 12:67464088-67464110 GAGAGAGGTCAGAAAAAAAATGG - Intergenic
1098870389 12:75810977-75810999 GGGACTGGTCAAAAGAACTATGG + Intergenic
1100076031 12:90785058-90785080 CAGACAGCTAACAAGAACCAGGG + Intergenic
1102834817 12:116045759-116045781 TAGACAGGTTACAAGTAAAATGG + Intronic
1104350909 12:128043096-128043118 GAGCTGGGTCACAAGAGCAAAGG + Intergenic
1106404056 13:29458221-29458243 AAGACAGGTCAGAAACACAAAGG - Intronic
1107991440 13:45822030-45822052 GACACATGTCACAAGAGCAAAGG - Intronic
1108520223 13:51240330-51240352 GAGTCAGGTCAAAATAAAAAGGG - Intronic
1109127802 13:58539949-58539971 GAGACAGATCATGAGAATAAAGG + Intergenic
1109849850 13:68048076-68048098 CAGACAGGTAACAAGTAAAATGG - Intergenic
1111243524 13:85506799-85506821 TAGACTGTTCATAAGAACAAAGG + Intergenic
1113097939 13:106686476-106686498 GAGCAAGATAACAAGAACAAAGG - Intergenic
1113762393 13:112858704-112858726 TTGACAGATCACAAGAAGAAGGG + Intronic
1117168840 14:53069110-53069132 GGGGTAGGTCACAAGAACACAGG - Intronic
1117342003 14:54799972-54799994 CAGACAGTTCACAAGCTCAAGGG + Intergenic
1118662754 14:68032517-68032539 TAGAGAGGGCAAAAGAACAAGGG - Intronic
1118705735 14:68478618-68478640 AAGATAGGTCACAAGGCCAAAGG - Intronic
1118982254 14:70726338-70726360 GACACATGTCCCAAGAACAAGGG + Intronic
1120999296 14:90440031-90440053 GAGCCAGGCCACAGGGACAAAGG + Intergenic
1121953077 14:98189197-98189219 GAGACAGTTCATCAGAACAAGGG - Intergenic
1202867711 14_GL000225v1_random:133666-133688 GAGACACGTCACAATAACCCCGG - Intergenic
1123976645 15:25559977-25559999 GAGAGAGGACACAGGAAGAAAGG - Intergenic
1124627701 15:31318437-31318459 GAGACAGGTCAAAAGCAGATAGG + Intergenic
1125893958 15:43286556-43286578 GAGACAGGTGCCAAAGACAAGGG - Intronic
1126205280 15:46038322-46038344 CAGCCAGGTCACAAGGACAAAGG - Intergenic
1126217275 15:46170575-46170597 TTGACAGATCACAAGAAGAAGGG + Intergenic
1127848441 15:62891875-62891897 GAGATATATCACGAGAACAAGGG + Intergenic
1128441776 15:67716438-67716460 GAGACATGTCACCAGAAGACTGG - Intronic
1129059559 15:72849827-72849849 GAGCCAGGAGACAACAACAAAGG - Intergenic
1130851656 15:87800665-87800687 GGGGCAGGTCAAAAGAACAAAGG - Intergenic
1131156685 15:90080129-90080151 GGGACAGGTCACAAGGGCACCGG + Exonic
1131440880 15:92458749-92458771 GAGACAGGGCAAAAGTGCAAAGG + Intronic
1133293799 16:4740194-4740216 CAGACAGAACACAAGGACAAAGG + Exonic
1133446871 16:5868733-5868755 GTGACTGGTCACAAGATCATGGG - Intergenic
1134231603 16:12434468-12434490 GAGACAGGACACACAAAAAATGG - Intronic
1135795054 16:25433756-25433778 CAGAAAGGTCACAAGGGCAAGGG - Intergenic
1136253584 16:29023863-29023885 CACACAGGTCTCAAGAACAAGGG - Intergenic
1138197793 16:55066152-55066174 GGGAGAGGTAACAAGATCAAAGG - Intergenic
1139319751 16:66104827-66104849 CTCACAGGTCACAAGACCAATGG + Intergenic
1142216440 16:88832180-88832202 GAGACTGGTCATAGGGACAAAGG + Intronic
1142499202 17:322949-322971 GAGACAGATCAGAAAACCAAGGG - Intronic
1143662886 17:8337975-8337997 AAGACATGTCCAAAGAACAATGG + Intergenic
1144789786 17:17851005-17851027 GAGACAGAACACCGGAACAAAGG + Intronic
1146228337 17:31087207-31087229 GACCCAGGTAAAAAGAACAAAGG + Intergenic
1146672906 17:34754232-34754254 GAGAAAGGTCAAAAGCAAAAGGG + Intergenic
1147521678 17:41179236-41179258 AAAACAGGTATCAAGAACAAAGG + Intergenic
1147636136 17:41965716-41965738 GAGAAAGGTGCCAAGAAGAAAGG + Intergenic
1147762294 17:42806866-42806888 GAGACAGACCACAAGAACTTGGG + Intronic
1147774145 17:42888739-42888761 GAGACAGGTTACTACAACATGGG - Intergenic
1148536361 17:48442358-48442380 TAGGCAGGTCTGAAGAACAAGGG - Intergenic
1148580744 17:48741907-48741929 GAGGCAGATCACTTGAACAAGGG - Intergenic
1149447767 17:56726908-56726930 TTGACAGGTCACAAGAAGAAGGG - Intergenic
1151197191 17:72440034-72440056 GAAACAGGGCACCAGAGCAATGG - Intergenic
1152941243 17:83173845-83173867 GACACAGGTCAGATGAACAAAGG - Intergenic
1153368645 18:4288029-4288051 GAGTCAGGTCAGGAGAATAAAGG + Intronic
1155278073 18:24209277-24209299 CAGACACGTCACAAAAACAATGG + Intronic
1155437144 18:25825370-25825392 GAGACAAGACAGAAGACCAAAGG + Intergenic
1156044888 18:32866944-32866966 GAGACAGCTCATAAGACAAAAGG + Intergenic
1157812461 18:50707206-50707228 GAGGCAGGGGGCAAGAACAATGG + Intronic
1158605371 18:58891144-58891166 CAGGCAGATCACAAGATCAAGGG - Intronic
1158958428 18:62565392-62565414 GAGACAGGTCCCAAGGCCATGGG + Intronic
1158967373 18:62634382-62634404 GAAGCAGGTTCCAAGAACAAAGG - Intergenic
1160778201 19:866377-866399 CAGCCAGGTCACCAGAACCACGG + Intergenic
1163246068 19:16095219-16095241 GAGACAGTTCAGAAGTACAGGGG - Intronic
1165018824 19:32906065-32906087 GAGAAAGGTCAAAAGTAAAAGGG - Intronic
1167867652 19:52341255-52341277 GAAACAGGTCGCAGGAGCAATGG - Intronic
927378668 2:22451042-22451064 GACACAGTTCTCTAGAACAAAGG - Intergenic
929816016 2:45232232-45232254 CAGGCAGGTCAAAAGGACAAAGG + Intergenic
930232313 2:48855916-48855938 GAGAAGTGCCACAAGAACAAAGG + Intergenic
931304561 2:61016108-61016130 CAGTAAGTTCACAAGAACAAAGG + Intronic
932720917 2:74138605-74138627 GAGGCAGATCACATGAAGAATGG + Intronic
932991142 2:76789377-76789399 GAGAGAGGTCACTAGAGCAGAGG - Intronic
934926789 2:98387809-98387831 GAGAGAGGTTTCAAGAACAGCGG + Intronic
935461629 2:103342617-103342639 GAGCAAGGTCACAAGATAAAAGG - Intergenic
937337293 2:121069824-121069846 CAGACAGGGCACAAGGACAGGGG - Intergenic
938610779 2:132945358-132945380 AAGACAGGACAGATGAACAAGGG + Intronic
940752603 2:157643748-157643770 GAGACAGCAGACAAGAACAGAGG - Intergenic
942023232 2:171887685-171887707 GAGAGAGGTTAAAAGAAAAAAGG + Intronic
942938247 2:181584668-181584690 GAGACAGGTTAAATGAAAAATGG - Intronic
943658113 2:190530353-190530375 GAGAGAGGTGATAAGAAAAAAGG - Intronic
944106897 2:196089003-196089025 AAGACAGGCCACAAGAACTATGG - Intergenic
945525087 2:210878353-210878375 GGGATATGTCAAAAGAACAAAGG - Intergenic
945625953 2:212206120-212206142 GAAACAGGTCAGTAGAACCAGGG - Intronic
946136728 2:217653726-217653748 GAGAGTGGGCACCAGAACAAAGG + Intronic
946229588 2:218283103-218283125 GAGTCAGGCCACAAGGTCAAGGG + Intronic
946846705 2:223865456-223865478 GTGACAGGTCAAGAGGACAAGGG + Intronic
947534946 2:230934501-230934523 GACACAGGTCAGAAGAACCAGGG + Intronic
948765290 2:240216281-240216303 GAGACACGACCCAAGAAAAAGGG + Intergenic
1169287607 20:4322516-4322538 GAGAAAGGGGACAAGAAAAATGG - Intergenic
1171180866 20:23089285-23089307 GAGGCAGGTCACAAGGACAGGGG - Intergenic
1173349642 20:42233127-42233149 GAGAAAGGGGACAAGAACAGAGG - Intronic
1173964896 20:47105181-47105203 AAGACTGGTCATAAGAACAAAGG - Intronic
1175103997 20:56601067-56601089 GAGACAGGTAACAAAAGCACTGG - Intergenic
1177201486 21:17961829-17961851 AAGAGAGGTCACAAAAAGAATGG + Intronic
1177530998 21:22357660-22357682 AAGACAGGTTGCAAGAACAGAGG + Intergenic
1178613920 21:34113546-34113568 GAGAAAGGACACAAACACAAAGG - Intronic
1178738428 21:35173940-35173962 AAGATAAGTCACAAGAAAAAGGG - Intronic
1178951181 21:36987068-36987090 GAGACAGGTCAGAAGGACACAGG - Intronic
1182189829 22:28447236-28447258 GAGACAGGTTAAAAAAAAAAGGG + Intronic
949420651 3:3862438-3862460 GGGACAGGTCAAAAGGACACAGG - Intronic
950790035 3:15464210-15464232 GAGACAGGTCTCAGAAAGAATGG + Intronic
952413861 3:33073056-33073078 CAGGCAGGTCACAGCAACAATGG - Intronic
953932349 3:47011866-47011888 GAGACAGGACACAAGTGCCATGG + Intergenic
954101855 3:48379808-48379830 GAGACAGGTATCAAGAAATAGGG + Intronic
954300528 3:49698643-49698665 GAGACTAGCCACAAGGACAAAGG - Intronic
954865449 3:53725329-53725351 GGGACTGGTCATATGAACAACGG - Intronic
955244665 3:57213372-57213394 CAGGCAGGACATAAGAACAAGGG - Intronic
955787072 3:62551889-62551911 GAGATAGGTCACAAGAAGGGAGG - Intronic
956495785 3:69824527-69824549 GAGAGAAGTCACAGGAAGAAGGG + Intronic
960159429 3:114333984-114334006 GAGTCAGGTCACAACAGAAAGGG + Intergenic
962702230 3:138010669-138010691 GAGGCAGGCCTCAAGAAGAATGG + Intronic
967440718 3:189505339-189505361 GAGCCACATCACAAGAAGAAGGG - Intergenic
967570827 3:191026447-191026469 GATACAGGCCAGAAGAAAAAAGG + Intergenic
968279062 3:197461726-197461748 AAGACTGGTCACAAGAACCTTGG - Intergenic
969152259 4:5179656-5179678 GAGAAAGGTCACCAGATCATTGG + Intronic
970518276 4:16857197-16857219 GAGACATGTCAAAGAAACAAAGG - Intronic
971815614 4:31484217-31484239 CAGGCAGGTCACAAGATCAGGGG + Intergenic
972038866 4:34563749-34563771 AAGACATGTAACAAGAAAAATGG + Intergenic
973087154 4:46079324-46079346 GAGACAGGGCTGAGGAACAAGGG - Intronic
973190587 4:47381084-47381106 GAGACAGTGCACAAGGACTAGGG - Intronic
973193276 4:47410854-47410876 AAGATAAGTCACAAGAATAAGGG + Intronic
974515580 4:62904215-62904237 GAGACAGAACACAAGAAAAAAGG - Intergenic
978180556 4:105789903-105789925 GAGAAAATTCAAAAGAACAATGG - Intronic
979320250 4:119315019-119315041 GGGACAGGACATTAGAACAATGG - Intergenic
980697233 4:136375017-136375039 GATGCATGTCACAAGGACAAAGG + Intergenic
982131866 4:152236327-152236349 GAGCCAGGTCAAAAGAACCCAGG + Intergenic
986018688 5:3780893-3780915 GAGACTGGTCATAGGAAAAATGG + Intergenic
988628945 5:32908583-32908605 GAGACAGCTCATAATAAAAATGG + Intergenic
988812059 5:34795182-34795204 TAGACTGGTCACTAGAAGAAGGG - Intronic
989030866 5:37116965-37116987 GACAGAGGCCACAAGAACAAGGG + Intronic
990373590 5:55146454-55146476 GAGAAATGACACAAAAACAAAGG - Intronic
990662657 5:58034725-58034747 GAGACAGGACAGAGGAAAAAGGG - Intergenic
991461491 5:66863699-66863721 GAGACAGGAGACAAGAAGGAGGG + Intronic
992159110 5:73983434-73983456 GACACAGATCACAAGAGCAGAGG - Intergenic
992365685 5:76086768-76086790 GAGACAGCTAAAAATAACAATGG + Intronic
992822980 5:80517095-80517117 TTGACAGATCACAAGAAGAAGGG + Intronic
993460294 5:88173803-88173825 TTGACAGATCACAAGAAGAAGGG - Intergenic
996763712 5:127013624-127013646 GAGACAAGTCAGAAAAAGAAAGG - Intronic
996912175 5:128668575-128668597 GAGACATGTCTGAAGGACAATGG - Intronic
996969272 5:129343952-129343974 GAGGCAGGTCACAAGTCCTAAGG - Intergenic
997541231 5:134664632-134664654 TAGACAAGTCAAAGGAACAAAGG - Intronic
998455189 5:142266626-142266648 GAGAGAGGTAATAAGAAAAATGG - Intergenic
1000283917 5:159809953-159809975 GAGACATTTCAAAATAACAAAGG + Intergenic
1000793469 5:165635017-165635039 GAGACAGGGCACAATAAAAATGG - Intergenic
1003494392 6:6651600-6651622 GAGGAGGGTCAGAAGAACAATGG - Intronic
1003626180 6:7743618-7743640 GAGCCAGGTCTCAAGCACCAAGG - Intronic
1003675487 6:8200867-8200889 GAGACAGCTCACTAGAAGCAGGG + Intergenic
1004038900 6:11954919-11954941 GAGCCATGTCAGAAGAACAGAGG + Intergenic
1004314489 6:14573968-14573990 GAGACTGCAAACAAGAACAAAGG - Intergenic
1004865801 6:19853034-19853056 GTGACAGGTCACAGGGACATAGG + Intergenic
1006283887 6:33078409-33078431 CAAACAGGGCACAAGACCAAAGG + Intronic
1006680647 6:35794880-35794902 CAGGCAGGTCAGAAGAACAAGGG - Intergenic
1007523689 6:42472396-42472418 GATACATTTTACAAGAACAACGG + Intergenic
1007599368 6:43072249-43072271 GAGACAGGTCAGAAGCCCAGAGG + Exonic
1008704146 6:54137484-54137506 GAGCCGGGTCACCAGATCAAGGG + Exonic
1012073898 6:94658563-94658585 GTGACAAGTGACAACAACAAAGG - Intergenic
1012272560 6:97232596-97232618 GAGTCATGTCAGAAGAACACAGG - Intronic
1012602437 6:101114726-101114748 AAGACAGGACACAAGAAAGATGG - Intergenic
1013153110 6:107465665-107465687 GGGACAGGTCAGAGGCACAAAGG + Intergenic
1013393820 6:109713885-109713907 GAGAGAGGTCAGCAGACCAAGGG + Intronic
1015491903 6:133836437-133836459 TAGTCAGCTCACGAGAACAAAGG + Intergenic
1015625416 6:135176776-135176798 GAGGCAGATCAGAAGAACATAGG - Intergenic
1016583813 6:145661044-145661066 GAGACAGGGCACAGCAACAGAGG + Intronic
1017164757 6:151397347-151397369 GAGACAAGTAACAAGCAAAAAGG - Intergenic
1017830483 6:158123711-158123733 GAGACTGGTAACAGGATCAAAGG + Intronic
1018939199 6:168297187-168297209 GAGTGTGGTCAGAAGAACAATGG + Intronic
1019161209 6:170068013-170068035 GAGACAGACCAGCAGAACAAAGG - Intergenic
1019997959 7:4737136-4737158 GACTGAGGTCACAAGAAGAAGGG - Intronic
1020912786 7:14154030-14154052 GAGACGAGTCAAAAAAACAAAGG + Intronic
1021191218 7:17622004-17622026 GATATAGGTCAAAAGAACATGGG + Intergenic
1022345285 7:29508721-29508743 GAGACTGGACACATTAACAATGG - Intronic
1022749352 7:33207513-33207535 AAGACATGTCACAAGGACACAGG - Intronic
1025607773 7:63051717-63051739 GAGAGATGTCACAAGAACACAGG - Intergenic
1026143726 7:67727663-67727685 ATGACATGTCACAAGAACACTGG + Intergenic
1026410550 7:70117420-70117442 GAGACAAGACAGAAGAAAAAAGG + Intronic
1027455341 7:78384316-78384338 GTGACAAGTCACAAGATCCATGG + Intronic
1027754323 7:82192517-82192539 GAGACAGGTAAAAAGAATCAAGG + Intronic
1028959877 7:96736647-96736669 GAGACAGGTCAAATGATGAAGGG + Intergenic
1030579860 7:111341310-111341332 GAGACAGGTGCCTAGAACAGTGG - Intronic
1030711782 7:112758270-112758292 CAGAGAAGTCACAAGAGCAAGGG - Intergenic
1031607989 7:123792648-123792670 GAGACAGGGCATGAGAATAAAGG - Intergenic
1032464382 7:132134682-132134704 GAGACAGGCAACAAGGCCAAGGG + Intronic
1033940510 7:146646998-146647020 GAGGCAGGGCACAATATCAATGG + Intronic
1034721292 7:153295806-153295828 GAGAGAGGTCCCAGGAACAGGGG + Intergenic
1039050347 8:33486966-33486988 GAAACAGGTAAGAAGAATAAGGG - Intronic
1041541163 8:58986894-58986916 GAGACAGGACAGAAGCCCAAAGG - Intronic
1043716096 8:83488915-83488937 GAAACAGGTGAAAAGAACTAAGG + Intergenic
1045594842 8:103641758-103641780 AAGAGAGGACACAAGAAAAAGGG - Intronic
1046631719 8:116628433-116628455 GAGACAGGTTTTAAGAACACTGG + Intergenic
1048210675 8:132451905-132451927 GGGACAGGTCAAGAGAAAAATGG + Intronic
1050516803 9:6453185-6453207 GAGACAGGGCACCACAGCAAGGG - Intronic
1050655206 9:7820549-7820571 GAGTCAGGTCAAAAGAACTCGGG + Intronic
1052067209 9:24036632-24036654 GAGGCAGGTAAAAAGAACAGTGG + Intergenic
1054876303 9:70100016-70100038 GAGAGAGAGCACAAGCACAATGG + Intronic
1054914257 9:70481270-70481292 GAGAGAAGTCACCAGCACAAGGG - Intergenic
1055646645 9:78367720-78367742 GTGATAGGTCACAAGAAGAGGGG + Intergenic
1058319869 9:103615498-103615520 GAGAAAGGCTAAAAGAACAAAGG - Intergenic
1058335464 9:103822900-103822922 GAGACTGTTCAGAAGAAAAATGG - Intergenic
1058564371 9:106266016-106266038 TAGACAGGTCTCAAAAACCATGG + Intergenic
1060279601 9:122206922-122206944 GAGACAGGGGACAAGAAGAAGGG - Intronic
1060751228 9:126170772-126170794 GACACAGGAGACAAGAAGAAGGG + Intergenic
1062688053 9:137826464-137826486 GAGACAGGCCCCAGGAACCAGGG - Intronic
1186289483 X:8080872-8080894 AAGTCATGTCACAGGAACAAAGG + Intergenic
1186595636 X:10978912-10978934 GAGACAGGAAACCAGAACAGGGG + Intergenic
1187976018 X:24706264-24706286 GAGCCATGTCAAAAGAACATAGG - Intronic
1188076844 X:25787535-25787557 AAGACAGGCTACAAGAACAGTGG + Intergenic
1191756677 X:64600487-64600509 GAGACAGGTAACAAGAAAATTGG - Intergenic
1192492343 X:71587110-71587132 GAGACAGGTCCAAAGTACAAGGG + Intronic
1192501524 X:71656859-71656881 GAGACTGGTCAAGAAAACAAGGG + Intergenic
1192508590 X:71707729-71707751 GAGACTGGTCAAGAAAACAAGGG + Intergenic
1192512057 X:71726980-71727002 GAGACTGGTCAAGAAAACAAGGG - Intergenic
1192514640 X:71754525-71754547 GAGACTGGTCAAGAAAACAAGGG + Intergenic
1192518107 X:71773824-71773846 GAGACTGGTCAAGAAAACAAGGG - Intergenic
1194333282 X:92612931-92612953 GAAACAGAACACAAGAACAGGGG - Intronic
1194457967 X:94127948-94127970 GAGACAGATCACAAATAAAATGG - Intergenic
1194589366 X:95779230-95779252 GAGACAGTTCTCAAGAACTTAGG + Intergenic
1195272267 X:103243313-103243335 GGGACAGGTAACAAGAAACAAGG - Intergenic
1195281005 X:103332559-103332581 GAGACAGGGCTCAATAACAGAGG - Intergenic
1195413833 X:104598661-104598683 GAGAAAGGTCAAAGGAACAATGG - Intronic
1196657747 X:118237469-118237491 GAGCCAAGTCATATGAACAAAGG - Intergenic
1198432101 X:136577691-136577713 GAGACAGGCCACAGGCACAGAGG + Intergenic
1200330863 X:155296235-155296257 GACAAAGTTCACAAGAACATTGG + Intronic
1200641965 Y:5731958-5731980 GAAACAGAACACAAGAACAGGGG - Intronic
1201549758 Y:15207518-15207540 CACACAGGTCAACAGAACAAAGG + Intergenic
1201935002 Y:19400968-19400990 AACACTGGTCAAAAGAACAAGGG + Intergenic