ID: 1063961517

View in Genome Browser
Species Human (GRCh38)
Location 10:11309924-11309946
Sequence CCTGCTCTGGAGGTGGTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063961507_1063961517 23 Left 1063961507 10:11309878-11309900 CCTTAGGGGAAGTTACAGAGCCC No data
Right 1063961517 10:11309924-11309946 CCTGCTCTGGAGGTGGTGCAGGG No data
1063961509_1063961517 2 Left 1063961509 10:11309899-11309921 CCTTTGTTCTTGTGACCTGTCTC 0: 1
1: 0
2: 0
3: 26
4: 250
Right 1063961517 10:11309924-11309946 CCTGCTCTGGAGGTGGTGCAGGG No data
1063961508_1063961517 3 Left 1063961508 10:11309898-11309920 CCCTTTGTTCTTGTGACCTGTCT 0: 1
1: 0
2: 1
3: 29
4: 323
Right 1063961517 10:11309924-11309946 CCTGCTCTGGAGGTGGTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063961517 Original CRISPR CCTGCTCTGGAGGTGGTGCA GGG Intronic
No off target data available for this crispr