ID: 1063962162

View in Genome Browser
Species Human (GRCh38)
Location 10:11315623-11315645
Sequence AGGTATGGTCAGCTAAAGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 53}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063962162_1063962170 7 Left 1063962162 10:11315623-11315645 CCGAGCTTTAGCTGACCATACCT 0: 1
1: 0
2: 0
3: 1
4: 53
Right 1063962170 10:11315653-11315675 GGGACGGCTCGTGATTAGCGTGG No data
1063962162_1063962171 21 Left 1063962162 10:11315623-11315645 CCGAGCTTTAGCTGACCATACCT 0: 1
1: 0
2: 0
3: 1
4: 53
Right 1063962171 10:11315667-11315689 TTAGCGTGGAGCCCGTGAAGTGG No data
1063962162_1063962165 -9 Left 1063962162 10:11315623-11315645 CCGAGCTTTAGCTGACCATACCT 0: 1
1: 0
2: 0
3: 1
4: 53
Right 1063962165 10:11315637-11315659 ACCATACCTCCCAAATGGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063962162 Original CRISPR AGGTATGGTCAGCTAAAGCT CGG (reversed) Intronic
909882716 1:80900393-80900415 GGGTATGGTCAGCCAATGCCAGG + Intergenic
916890854 1:169111124-169111146 AGGAATGTTCAGCTAGAACTAGG - Intronic
1063962162 10:11315623-11315645 AGGTATGGTCAGCTAAAGCTCGG - Intronic
1071566351 10:86673271-86673293 AGGTGTGGTCAGCTACAGAGGGG + Intronic
1075010077 10:118860193-118860215 ATGTCTGGTCAGCTACAGGTTGG - Intergenic
1075773340 10:124959885-124959907 AGGTATAGCCAGGTATAGCTGGG + Intronic
1087755822 11:102053846-102053868 AGCAATGGTCAGATAAGGCTGGG - Intronic
1092981234 12:13796445-13796467 AGGCATGATCAACTATAGCTTGG + Intronic
1096172069 12:49479506-49479528 TGGTTTGGACAGCTACAGCTGGG + Intronic
1097881985 12:64694622-64694644 AGGTGTGGTCTGCAAGAGCTGGG - Intronic
1101582374 12:106053298-106053320 AGCCATTGTCAGCTAAGGCTTGG - Intergenic
1104377407 12:128277182-128277204 TGGTATGGTTTGCTTAAGCTGGG - Intronic
1104634853 12:130431851-130431873 AGGTGTGGTCATCCAGAGCTGGG + Intronic
1117623964 14:57616868-57616890 AGGTTTAGTCAGCTATAGCCAGG - Intronic
1125987644 15:44070760-44070782 AGCTATGTTCAGGTAAAGGTTGG - Intronic
1128506096 15:68273844-68273866 AGCTTTGGGCACCTAAAGCTGGG + Intergenic
1128637517 15:69312645-69312667 AGGTATGGGCAGCTGATCCTGGG - Intronic
1130778733 15:87012117-87012139 AGGTATGCTCTGCTAAATCAAGG + Intronic
1132405714 15:101540992-101541014 AGGTATGGGCAGCCAAAGTCTGG + Intergenic
1132736735 16:1389748-1389770 AGCTCTGGACAGCTCAAGCTCGG + Intronic
1141424636 16:83936856-83936878 AGGTCAGGTCTGCCAAAGCTGGG - Intronic
1151084343 17:71363716-71363738 TGGCATGGTCAACTCAAGCTTGG - Intergenic
1151864268 17:76789776-76789798 AAGTGTGGTCAGTTACAGCTTGG - Intergenic
1153581890 18:6582209-6582231 AGGCAGGGTCACCTATAGCTAGG - Intronic
1163389597 19:17022275-17022297 AGGTGTGGTCAGCAAAAGGCAGG - Intronic
926378516 2:12260488-12260510 AGGTATGTGCAGCTAAACTTTGG + Intergenic
927680409 2:25135435-25135457 AGGTATGGACAGCTATGCCTAGG - Intronic
933157311 2:78990629-78990651 AGGTATGTACAAATAAAGCTAGG - Intergenic
934477248 2:94601910-94601932 AGGGATGGGCAGCAACAGCTTGG + Intronic
935427827 2:102939626-102939648 AGTTTTGTTCAGATAAAGCTTGG + Intergenic
946226201 2:218265350-218265372 AGGTATGGGCAGCTGGAGCTGGG - Exonic
946418812 2:219553582-219553604 AGGTAACATCAGCCAAAGCTTGG + Exonic
1169493280 20:6089578-6089600 ATGTATGGTAACCTGAAGCTTGG - Intronic
1182328223 22:29530656-29530678 AGGTCTGTTCAACTTAAGCTTGG + Intronic
960942180 3:122942371-122942393 AAGGATGGTCAGCTACAGCATGG + Intronic
966579330 3:181542087-181542109 AGGTAAGGTCACCTAAGTCTCGG - Intergenic
967800254 3:193650390-193650412 TGGTATGAACAGCTAAGGCTTGG - Intronic
968671129 4:1852187-1852209 ATGTGTGGTCAGCTGAAGTTGGG - Intronic
972144454 4:36004405-36004427 AGTTTTTGTCAGGTAAAGCTAGG - Intronic
973003696 4:44984444-44984466 AGGTATGGTAAAATAAAGATTGG - Intergenic
973020432 4:45198929-45198951 AGGTGTGGCCAGATAAATCTGGG + Intergenic
974400474 4:61398602-61398624 TGGAATGGTCAGCAAAACCTAGG - Intronic
975643186 4:76520904-76520926 ATATTTGGGCAGCTAAAGCTAGG + Intronic
982662115 4:158219578-158219600 AGTTTTGGAGAGCTAAAGCTGGG - Intronic
982686563 4:158497293-158497315 AGGTATACACAACTAAAGCTGGG + Intronic
1000311177 5:160046284-160046306 AGGTAAGGTCAAGTAAAGTTAGG - Intronic
1000482900 5:161802011-161802033 AGGTATGGTCAAATTAAGCATGG - Intergenic
1011489348 6:87874697-87874719 ATGTCTGGTCACCTTAAGCTGGG + Intergenic
1023494040 7:40775630-40775652 AGGTATGTCCATCTAAAACTAGG - Intronic
1023543712 7:41294727-41294749 AGGCATGGTCAATTAAAGATTGG + Intergenic
1023718690 7:43071470-43071492 AGGTCTGTTCAGCTAAAGACAGG + Intergenic
1049696779 8:143987936-143987958 AGGTCTGGTCAGGTGCAGCTGGG - Intronic
1050308819 9:4332367-4332389 CCGTGTGCTCAGCTAAAGCTTGG - Intronic
1050794944 9:9526807-9526829 ATTTCTGGTCACCTAAAGCTTGG + Intronic
1188953287 X:36403685-36403707 AGCTCTGTTGAGCTAAAGCTTGG - Intergenic