ID: 1063962166

View in Genome Browser
Species Human (GRCh38)
Location 10:11315638-11315660
Sequence GCCGTCCCATTTGGGAGGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2397
Summary {0: 1, 1: 0, 2: 7, 3: 214, 4: 2175}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063962166_1063962170 -8 Left 1063962166 10:11315638-11315660 CCATACCTCCCAAATGGGACGGC 0: 1
1: 0
2: 7
3: 214
4: 2175
Right 1063962170 10:11315653-11315675 GGGACGGCTCGTGATTAGCGTGG No data
1063962166_1063962171 6 Left 1063962166 10:11315638-11315660 CCATACCTCCCAAATGGGACGGC 0: 1
1: 0
2: 7
3: 214
4: 2175
Right 1063962171 10:11315667-11315689 TTAGCGTGGAGCCCGTGAAGTGG No data
1063962166_1063962174 20 Left 1063962166 10:11315638-11315660 CCATACCTCCCAAATGGGACGGC 0: 1
1: 0
2: 7
3: 214
4: 2175
Right 1063962174 10:11315681-11315703 GTGAAGTGGTAGCTGTGCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063962166 Original CRISPR GCCGTCCCATTTGGGAGGTA TGG (reversed) Intronic
Too many off-targets to display for this crispr