ID: 1063962170

View in Genome Browser
Species Human (GRCh38)
Location 10:11315653-11315675
Sequence GGGACGGCTCGTGATTAGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063962166_1063962170 -8 Left 1063962166 10:11315638-11315660 CCATACCTCCCAAATGGGACGGC 0: 1
1: 0
2: 7
3: 214
4: 2175
Right 1063962170 10:11315653-11315675 GGGACGGCTCGTGATTAGCGTGG No data
1063962162_1063962170 7 Left 1063962162 10:11315623-11315645 CCGAGCTTTAGCTGACCATACCT 0: 1
1: 0
2: 0
3: 1
4: 53
Right 1063962170 10:11315653-11315675 GGGACGGCTCGTGATTAGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063962170 Original CRISPR GGGACGGCTCGTGATTAGCG TGG Intronic
No off target data available for this crispr