ID: 1063964434

View in Genome Browser
Species Human (GRCh38)
Location 10:11335669-11335691
Sequence TAGTGGGAAAGGATGGCTAA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 266}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063964427_1063964434 1 Left 1063964427 10:11335645-11335667 CCTCTGAAAACACACTGCCTACG 0: 1
1: 0
2: 0
3: 11
4: 113
Right 1063964434 10:11335669-11335691 TAGTGGGAAAGGATGGCTAAGGG 0: 1
1: 0
2: 2
3: 27
4: 266
1063964425_1063964434 22 Left 1063964425 10:11335624-11335646 CCTCATAGCCTTCGGCAGTCTCC 0: 1
1: 0
2: 4
3: 15
4: 124
Right 1063964434 10:11335669-11335691 TAGTGGGAAAGGATGGCTAAGGG 0: 1
1: 0
2: 2
3: 27
4: 266
1063964426_1063964434 14 Left 1063964426 10:11335632-11335654 CCTTCGGCAGTCTCCTCTGAAAA 0: 1
1: 0
2: 0
3: 9
4: 136
Right 1063964434 10:11335669-11335691 TAGTGGGAAAGGATGGCTAAGGG 0: 1
1: 0
2: 2
3: 27
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063964434 Original CRISPR TAGTGGGAAAGGATGGCTAA GGG Exonic
901169072 1:7242327-7242349 TAGTGGGAATGAATGGAAAATGG + Intronic
904006395 1:27365616-27365638 GGGCGGGAAAGGATGGCTCAGGG - Intronic
904741269 1:32678157-32678179 AAATAGGAAATGATGGCTAATGG - Intronic
904854367 1:33485964-33485986 AGGTGGGACAGGATGCCTAAAGG + Intronic
905242920 1:36592776-36592798 TAGTGGGAAAGTATGGAACAGGG - Intergenic
906754416 1:48295584-48295606 TAGTGGGAAGTGATCACTAATGG + Exonic
908078221 1:60544264-60544286 TAATGGGAAAGTAAGGATAAGGG - Intergenic
908576954 1:65470071-65470093 TTAGGGGAAAGGATGTCTAAGGG - Intronic
909597652 1:77423951-77423973 GGGTGGGACAGGATGGCTAGAGG - Intronic
911155381 1:94631212-94631234 GAATGGGAAGTGATGGCTAATGG - Intergenic
912391943 1:109308984-109309006 TAGCAGGGTAGGATGGCTAACGG + Intergenic
912944657 1:114074927-114074949 TAGTGGGGAGGGATGGTAAATGG + Intergenic
916048653 1:161019636-161019658 TAGTGGGAAAGTAAGTTTAAAGG + Intronic
916475695 1:165166490-165166512 GAGTGGGAAAGGTGGCCTAAAGG - Intergenic
918368841 1:183838365-183838387 TACTGAGACAGGATGGCAAAGGG + Intronic
919036139 1:192311659-192311681 TAGGGAGAAAGGATGGCATAGGG - Intergenic
919731085 1:200914018-200914040 TAGTGGGACAGGAGGGCCAGGGG - Intronic
919782492 1:201229741-201229763 TAGTGGCAAAGGGAGGCTGAGGG - Intergenic
920833592 1:209487346-209487368 AAGTGGAAAAGGATGGATAGGGG - Intergenic
921093697 1:211868402-211868424 AAATGGGACAGGATTGCTAAAGG + Intergenic
921339642 1:214121980-214122002 TAGTGGGGAAAGCTGGCTGAAGG + Intergenic
921841402 1:219832577-219832599 TAGTGGGAGAAGTTGGGTAAGGG - Intronic
921964698 1:221075965-221075987 TAGTGAGAAAGGAGGGCTGGAGG - Intergenic
922028507 1:221776120-221776142 TATTGGAAACTGATGGCTAATGG - Intergenic
923792129 1:237120761-237120783 TAATGGTAAAGGATGAATAAGGG + Intronic
924278688 1:242413826-242413848 AAGTGGTATAGGATTGCTAAAGG + Intronic
1063369985 10:5514902-5514924 CAGTGGGAAAGGAAGGCCCAGGG + Intergenic
1063964434 10:11335669-11335691 TAGTGGGAAAGGATGGCTAAGGG + Exonic
1064796075 10:19012634-19012656 TGGTGGAACAGGATGGCTACAGG + Intergenic
1065051349 10:21795549-21795571 GAGTGGGAAATGATTGCTAATGG + Intronic
1065326422 10:24553999-24554021 GAGTGGGAATGGATGTCTTAGGG + Intergenic
1066663021 10:37755066-37755088 TAGGGGAAAATAATGGCTAATGG - Intergenic
1068606465 10:59010347-59010369 TAGAAGGAAAGAATGTCTAAAGG - Intergenic
1068733517 10:60386283-60386305 CAGTGGGAAAGTATGGCTAAGGG + Intronic
1068961369 10:62869833-62869855 AAGTGGGGAAGGATGGCAACTGG - Intronic
1069647191 10:70009289-70009311 AGGTGGGACAGGATGGCTACAGG - Intergenic
1069816564 10:71199535-71199557 TAATGGGAAATTATGGCTGAAGG + Intergenic
1070467542 10:76738756-76738778 TCCTGAGAAAGGATAGCTAAAGG + Intergenic
1070836674 10:79451796-79451818 AAGTAGGCAAGGAAGGCTAAGGG - Intergenic
1071325331 10:84510127-84510149 TAGTGCAAAAGCATAGCTAAGGG - Intronic
1071914209 10:90272823-90272845 TTGTAGGAAAGGTTGGCCAAAGG - Intergenic
1072817095 10:98520127-98520149 TGGTGGGAAAGCATGACAAAAGG + Intronic
1073711002 10:106040988-106041010 TACAGTGAAAGGATTGCTAAGGG + Intergenic
1074011530 10:109486452-109486474 TAGTAGGAAAAGATGGCCTAGGG - Intergenic
1075261880 10:120970289-120970311 TAGTGGAAATGGATGGCAATGGG + Intergenic
1076494912 10:130890753-130890775 AAGTGGGAAAGGAGGGGGAAGGG + Intergenic
1077347503 11:2070666-2070688 TAGTGGGACAGGATGGTGGAGGG - Intergenic
1078554424 11:12309321-12309343 AAGTGGGGAGGGAAGGCTAAAGG - Intronic
1080420844 11:32109193-32109215 TAGTCCCAAAGGATGGCCAACGG + Intergenic
1081555791 11:44159832-44159854 AGGTGGGACAGGATGGCTACAGG + Intronic
1089612910 11:119679576-119679598 TGGTGGGAAAGTGTGGCTGATGG - Intronic
1090234826 11:125139588-125139610 TGGTGGGGAAGGAGGGCGAAAGG - Intergenic
1091649890 12:2302217-2302239 CAGTGGGAGAGAATGGCGAATGG - Intronic
1092146241 12:6216610-6216632 AAGTGGGGAAGGAAGGCTAAAGG - Intronic
1094780438 12:33786359-33786381 TACTGGGAGAGGCTGGTTAATGG - Intergenic
1096257726 12:50073311-50073333 CAGTGGGAAAGGGAGGCTGATGG - Intronic
1098330609 12:69348503-69348525 GATTGGGAATGGATGGCTACAGG + Exonic
1098926220 12:76351691-76351713 TAGCTGCAAAGGATGGCAAAGGG - Intergenic
1099787147 12:87280220-87280242 TAGAGGTAAAGGATTGCTATAGG + Intergenic
1100722033 12:97369341-97369363 CAGGGGGAAAGGATGGAAAAGGG + Intergenic
1105548705 13:21371535-21371557 GAGTGAGAAATGATGGCTTATGG - Intergenic
1105959815 13:25322043-25322065 CAGTGGGAAAGGATGACGATAGG + Intronic
1106434181 13:29709170-29709192 AAATGGGAAATGATTGCTAATGG - Intergenic
1107419355 13:40232366-40232388 TAGTTGGAGATGATGTCTAAGGG + Intergenic
1110445200 13:75572733-75572755 TATTTGGAAACAATGGCTAATGG - Intronic
1111224211 13:85248198-85248220 TAGTGGAAAAGGATCCCAAAAGG + Intergenic
1111440077 13:88270471-88270493 TAGAGGGAAAGCATGTGTAATGG - Intergenic
1113433884 13:110273919-110273941 TAGTGAGAAAGGAAGGGAAATGG - Intronic
1114051915 14:18927375-18927397 AAATGGGAAAAGATTGCTAATGG + Intergenic
1114110643 14:19474546-19474568 AAATGGGAAAAGATTGCTAATGG - Intergenic
1114411981 14:22509475-22509497 TAGGTGGAAAGGATGGCTGAAGG + Intergenic
1116829690 14:49706103-49706125 GGGTGGGTAGGGATGGCTAATGG - Intronic
1117260028 14:54022758-54022780 AGGTGGGACAGGATGGCTAAAGG + Intergenic
1117483937 14:56174863-56174885 TAGTGGGAAAGGAGGGTAAAAGG - Intronic
1117608054 14:57452187-57452209 AGGTGGGACAGGATGGCTATAGG + Intergenic
1120623773 14:86798783-86798805 GAGTGGGAAAGGTTGGTTTAAGG - Intergenic
1121321757 14:92995644-92995666 TGCAGGGAGAGGATGGCTAAGGG - Intronic
1122220674 14:100237898-100237920 TAGGGGGAAAGGGTGGGCAAGGG + Intergenic
1124142300 15:27088288-27088310 GAGTGGGAAGTGGTGGCTAAAGG + Intronic
1124589638 15:31041534-31041556 AGGTGGGACAGGATGGCTAGAGG - Intronic
1125843368 15:42826918-42826940 TAGGGGGAAAAGATAGCTGAAGG + Intronic
1126978669 15:54216143-54216165 TAGAGGCAAAGGAGGGGTAAAGG + Intronic
1127396174 15:58545718-58545740 TAATGGGAAAGCAGGGGTAAGGG - Intronic
1129921535 15:79323202-79323224 TAATGGGCAAGGAGGACTAAGGG - Intronic
1133110315 16:3544186-3544208 TAACGTGAAAGGATGGCGAAGGG + Intronic
1135407917 16:22211349-22211371 TAGTGGGAAAGACTGGCTCATGG - Intronic
1135887522 16:26324571-26324593 TAGTGGGACAGGAAGGCTACAGG - Intergenic
1137519096 16:49176616-49176638 GAGTGGGAAAAGATGGCAACAGG - Intergenic
1138756517 16:59492973-59492995 GAGTGGGGAAGGATAGATAATGG + Intergenic
1140523167 16:75599566-75599588 TAGTAGGAAAAGATGGCCACCGG + Intronic
1141579616 16:84988261-84988283 AACTGGGAAGTGATGGCTAAGGG + Intronic
1145097605 17:20044298-20044320 TAGTGGTAAAGTATGGGTATGGG + Intronic
1147269478 17:39257824-39257846 TAGAGGGAAAGGATGGGTGTGGG + Intergenic
1148029374 17:44608969-44608991 CAGTGGGAAGGGGTGGCAAAGGG + Intergenic
1148199337 17:45739736-45739758 TAGTGGGAAAGGATCACTTGGGG + Intergenic
1149603337 17:57907459-57907481 TAGTGGGAAAGTGGGGGTAAGGG + Intronic
1152320225 17:79604682-79604704 TAGTGAGAAATGATTTCTAAAGG + Intergenic
1155869608 18:31009498-31009520 TAGTGGGCATGGATGGATAAAGG - Intronic
1158131123 18:54153641-54153663 TAGTGAGAATGGATGTCCAAGGG - Exonic
1158352697 18:56578958-56578980 GGGTGGGACAGGGTGGCTAAAGG - Intergenic
1158468662 18:57714216-57714238 TAGTGGAAAGGACTGGCTAATGG + Intronic
1162325230 19:9995446-9995468 TAGTGGGAAAAGAGTGCTGAAGG - Intronic
1162562511 19:11425866-11425888 AGGTGGGAAAGGATGGGTAGGGG + Intronic
1163400579 19:17089911-17089933 GAGTGGGGAGTGATGGCTAATGG - Intronic
1165801621 19:38555045-38555067 AAGTGGGAAATGACTGCTAATGG - Intronic
1166554606 19:43689936-43689958 TAGTGAGGAAGGATGGCTGTAGG + Intergenic
1167571534 19:50292071-50292093 GAGTGGGAGAGGCTGGCTCAGGG + Intronic
1168479554 19:56707650-56707672 TAATGGGAGTGGATGGCTATGGG + Intergenic
927951680 2:27174466-27174488 CAGTGGGAGAGGAGGGGTAAGGG - Intergenic
928452974 2:31395282-31395304 TGGTGGGACAGGATGGCTGGAGG + Intronic
928874847 2:36025963-36025985 TAGTTGAAAAGGAAGGTTAATGG + Intergenic
929287010 2:40146805-40146827 AAGCGGGTAGGGATGGCTAATGG - Intronic
931618403 2:64185205-64185227 TAGTGGGAAAATATTCCTAAAGG + Intergenic
932118874 2:69079540-69079562 TAGTGGGACAGTTTGGGTAAAGG + Intronic
934796876 2:97108895-97108917 TAGAGGGAAAGGGCGGCTGAGGG + Intergenic
935209450 2:100925922-100925944 GAATGGGAAATGATGGCTAATGG - Intronic
935433061 2:102998970-102998992 AGGTGGGACAGGATGGCTAGTGG + Intergenic
937597962 2:123692602-123692624 TGGTGGGACAGGATGGCTGGAGG - Intergenic
938015445 2:127863423-127863445 TTGTGGGAAGGGATGGGCAAGGG - Exonic
938821494 2:134964775-134964797 TTGTGGGGAATGATGGCTAAGGG - Exonic
940296048 2:152125592-152125614 TACTGGAAAAAGATGGCTTATGG + Intronic
940418745 2:153454118-153454140 TAGTAGGGAAGGATGGAGAAGGG + Intergenic
940482161 2:154247069-154247091 TAATGGAAGAGAATGGCTAAAGG + Intronic
942675867 2:178426484-178426506 CAGTGTGAAAGGCCGGCTAAAGG + Intergenic
943431871 2:187812976-187812998 TAGAGGGAAAGGGTGGGAAAGGG + Intergenic
943568639 2:189545844-189545866 TAGTAGGAGAAGATGGCTCAAGG - Intergenic
944770170 2:202905897-202905919 AAGTGGAAATGGATGGTTAATGG + Intronic
946178574 2:217936749-217936771 GTGTGGGAAAGGATGGCTTTGGG - Intronic
946548701 2:220776458-220776480 GAAAGGGAAGGGATGGCTAAGGG + Intergenic
947280569 2:228448470-228448492 CTATGGGAAAGGAGGGCTAAAGG - Intergenic
947398694 2:229712466-229712488 TAGTGGGAATGGATGGGAGAAGG - Intronic
1168931447 20:1627530-1627552 TGGTGGGACAGGATGGCCAGAGG - Intergenic
1168990947 20:2095302-2095324 TCGTGTGAAAGGAGGGCCAATGG + Intergenic
1170107897 20:12771816-12771838 TGGTGGGAATGAAGGGCTAATGG + Intergenic
1170746197 20:19100980-19101002 TATTGGGAAAGGATAGAGAATGG - Intergenic
1172496203 20:35386784-35386806 TAGTGTGAAATGTTAGCTAATGG - Intronic
1173207410 20:41005922-41005944 TAGTGGGAAAGGGTGAGTGAAGG - Intergenic
1173225105 20:41157966-41157988 GACTGGGGAAGGATGGCTGATGG + Intronic
1173293437 20:41734470-41734492 TCTTGGGAATGGAGGGCTAAAGG + Intergenic
1173739727 20:45390481-45390503 TACCGTGAAAGAATGGCTAAAGG - Intronic
1175292065 20:57882542-57882564 AAGTGGGGAGGGATGGCTGACGG + Intergenic
1175296748 20:57913831-57913853 TAGTTGGAGAGGCTGGGTAATGG - Intergenic
1175680155 20:60981066-60981088 TTGGGGGGAAGGATGGTTAATGG + Intergenic
1177064998 21:16419541-16419563 TAGTGGGAGAGGTTGTCTACTGG - Intergenic
1177412444 21:20747708-20747730 GAGTGAGGAAGGATGGCTAAAGG - Intergenic
1179489011 21:41728266-41728288 TTGTGGGAAGGGGTGGCTCAGGG - Intergenic
1180470389 22:15649751-15649773 AAATGGGAAAAGATTGCTAATGG + Intergenic
1181896081 22:26108911-26108933 CAGTGGGACAGGATGGGGAATGG - Intergenic
1183947683 22:41335988-41336010 TCCTGGGAAAGGAAGGCTAGTGG + Intronic
949453034 3:4208235-4208257 AGGTGGGACAGGATGGCTAGAGG - Intronic
950602382 3:14046007-14046029 TAGTGGGAAAGGTGGTCTAAAGG + Intronic
952256718 3:31701961-31701983 TAGAGGGAAAAGATGGGGAAGGG - Intronic
953677166 3:45011906-45011928 TGATAAGAAAGGATGGCTAAGGG - Intronic
956524486 3:70142531-70142553 TAGGGGGAAAGGGTGGGAAAGGG + Intergenic
956551030 3:70460317-70460339 AAGTGGGGAAGGAAGGGTAAGGG - Intergenic
956812914 3:72881747-72881769 AGGTGGGACAGGATGGTTAAAGG + Intergenic
957205050 3:77186023-77186045 TAGGGGGAAAGGATGGAAAGGGG + Intronic
958439855 3:94143054-94143076 GAGAGGTCAAGGATGGCTAAAGG + Intergenic
959951529 3:112185069-112185091 TAGTGGGACAGGAGGGCCAGGGG + Intronic
960572200 3:119196278-119196300 TGGTGGAAAAGGATGGCAAGAGG - Intronic
961444807 3:126974802-126974824 TACTGTGAAAGGAGGGCCAAAGG - Intergenic
961742564 3:129041960-129041982 AGGTGGGACAGGATGGCTGAAGG - Intergenic
962469985 3:135698184-135698206 AGGTGTGAAGGGATGGCTAATGG + Intergenic
962942076 3:140134232-140134254 TAGGGGGAGAGGAGGGATAAAGG - Intronic
963358874 3:144245017-144245039 TAGTAGAAAAGGATGGCAATGGG - Intergenic
963636231 3:147800340-147800362 GAGTGGGACAGGTAGGCTAAAGG + Intergenic
964939798 3:162143901-162143923 AAGTGGGAGAGGAAGGCAAATGG - Intergenic
968551014 4:1223397-1223419 TAGTGGGAGAGGTTGGTTCACGG - Intronic
972933855 4:44106986-44107008 AGGTGGGAGAGGATGGCTAGTGG + Intergenic
973304462 4:48629807-48629829 TACTCTGAAAGTATGGCTAAAGG + Intronic
974158130 4:58101288-58101310 TAGTGGGAAAAGATGCCTTATGG - Intergenic
977322198 4:95531754-95531776 TGGTGGGAAAGGATGCCTATAGG - Intronic
978651769 4:111014234-111014256 AAATGAGAAAGGATTGCTAATGG + Intergenic
979147937 4:117269426-117269448 TAGGTGGAAAGGATGGCTGGAGG + Intergenic
979847294 4:125531900-125531922 TAGAGGGTAGGGATGACTAATGG - Intergenic
980733184 4:136848572-136848594 TTGGGGGAAAGGGTGGCTATGGG - Intergenic
982663168 4:158229726-158229748 CAGTGAGAAAGGATGGGTCAGGG + Intronic
984148910 4:176101218-176101240 AGGTGGGACAGGATGGCTGAAGG - Intronic
985010971 4:185581684-185581706 TACAGTGAAGGGATGGCTAAAGG - Intergenic
985917698 5:2936802-2936824 AAGTGGGAAATGATTGCTAATGG + Intergenic
986223567 5:5792340-5792362 TACTGGCAAATGATGGCAAAAGG - Intergenic
986470357 5:8067681-8067703 GAGTGGGAAAGGAAGGCTGGAGG + Intergenic
986621384 5:9679199-9679221 CAGGGGGAAAGGAAGGATAATGG + Intronic
987140375 5:14939665-14939687 TAGTGGACAACGATGGCTATTGG + Intergenic
987796640 5:22636670-22636692 CAATGGGGAATGATGGCTAATGG + Intronic
989619712 5:43372324-43372346 TAATGAGAAAGGATGTCTAAAGG - Intergenic
990092917 5:52077219-52077241 GAGTGGGAAAAGATGATTAAAGG + Intronic
992033385 5:72746761-72746783 AGGTGGGACAGGATGGCTAGAGG - Intergenic
993656776 5:90587329-90587351 TAGTGGGGAATGATGGTTAGAGG + Intronic
994717918 5:103346320-103346342 AAGTGGGACAGGATGGCTAAAGG + Intergenic
994807329 5:104466340-104466362 TAGTGGAAAAGGATGATGAAAGG + Intergenic
996201992 5:120686558-120686580 TAGTGGGAAAGGAGGGAGATGGG - Exonic
996302972 5:122009976-122009998 TAGTGGGAAGGGAAGGTTAAAGG - Intronic
996796402 5:127353001-127353023 TCTTGGGAAAGGAGGCCTAATGG - Intronic
996797884 5:127370072-127370094 AAGAGGGAAAGCATGGCTCAGGG - Intronic
997704805 5:135938699-135938721 TAGTTGGTAAAGCTGGCTAATGG + Intronic
998772489 5:145562134-145562156 TAGTGGCAAAAGATGGCTTGTGG + Intronic
999596905 5:153214947-153214969 TAGTGAGGAAGGATGGGTCAGGG - Intergenic
999601569 5:153271950-153271972 AAGTGTGAAATGATTGCTAATGG - Intergenic
1001860951 5:175054804-175054826 TACTGGGTAAATATGGCTAATGG + Intergenic
1002816183 6:682733-682755 AAGTGGGAAAGGATTGATAATGG + Intronic
1003418090 6:5930937-5930959 GAGTGGGAAATGAAGGCTCAGGG + Intergenic
1004589273 6:17032773-17032795 TAGAGGGAATGGATGATTAAAGG - Intergenic
1004863213 6:19827530-19827552 TAGTGGGAAAGAGAGGCTATCGG - Intergenic
1005724431 6:28635054-28635076 GAATGGGTAAGGATGGGTAAGGG + Intergenic
1007687812 6:43677420-43677442 TTGTGGAATAGGATGACTAAAGG - Intronic
1008677463 6:53835220-53835242 AAATGGAAAACGATGGCTAAAGG - Intronic
1009554313 6:65142573-65142595 TACTGGGAAAAGCTGGTTAAGGG + Intronic
1010497120 6:76548200-76548222 AAGTGGGACAGGATGGCTAGAGG + Intergenic
1011434062 6:87318673-87318695 GAGTGGGAGAGCATGGATAAAGG + Intronic
1012353970 6:98290226-98290248 TAGTGGGAAATGAGGGATTAAGG + Intergenic
1012572872 6:100752497-100752519 GAGTAGGAAAAGATGGCTGAAGG - Intronic
1014203335 6:118627934-118627956 GAGTGGGACAGGATGGCTACAGG - Intronic
1014541837 6:122685768-122685790 TGGTAGTAAAGGATGGTTAATGG - Intronic
1018682896 6:166279731-166279753 TAATGGAAAAGGATGGTCAAAGG - Intergenic
1019551587 7:1605753-1605775 TAGTGGGGAGTGATGGCTTAAGG + Intergenic
1019591638 7:1838668-1838690 GACTGGGAGAGGATGGCTATGGG + Exonic
1021105362 7:16632382-16632404 AAGTGGGAAATGACTGCTAATGG - Intronic
1021336216 7:19405780-19405802 GAATGGGAAGTGATGGCTAACGG - Intergenic
1021463936 7:20920535-20920557 AAGTGGGAAATGTTGGCAAATGG - Intergenic
1022248256 7:28582094-28582116 TAGTGGGAAAATATTGCAAAGGG + Intronic
1022420401 7:30215431-30215453 AGGTGAGAAAGGATGGCTGAAGG - Intergenic
1022561023 7:31349649-31349671 TAGTGGTTAAGGATGGCAAATGG + Intergenic
1024736188 7:52307432-52307454 TAGTGAGAAAAGATAGCCAACGG - Intergenic
1026104556 7:67410570-67410592 TAGTGGGAGAGGGTGGGAAAGGG + Intergenic
1026337126 7:69404145-69404167 CAGGGGGAAAGGATGGGAAAGGG + Intergenic
1027429494 7:78095594-78095616 TAGAGGGCAAGGATGGTTCAAGG + Intronic
1027546961 7:79539348-79539370 TAGAGGGAAATGCTGGTTAAAGG + Intergenic
1028324658 7:89507365-89507387 TAGTTGGAAAGTATTGCTACAGG + Intergenic
1029032414 7:97482842-97482864 TAGTGGGAAAAGAAGGTTGAAGG - Intergenic
1029159837 7:98543799-98543821 GGCTGGGAAAGGATGGCTGAGGG - Intergenic
1030314940 7:108104900-108104922 ATGAGGGACAGGATGGCTAAGGG + Intronic
1032546536 7:132748490-132748512 GAGTGGGAAGGAATGGCCAATGG - Intergenic
1033460884 7:141546626-141546648 AAGTGGGAAATGATTGCTAATGG - Intergenic
1033496041 7:141897260-141897282 TGGTGGGAATAGATGGGTAAGGG + Intergenic
1035413794 7:158667396-158667418 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413804 7:158667425-158667447 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413883 7:158667654-158667676 TAGTGGGTAAGGAAGGCGGAGGG - Intronic
1035413934 7:158667800-158667822 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413955 7:158667859-158667881 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413965 7:158667888-158667910 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413994 7:158667973-158667995 TAGTGGGTAAGGAAGGCGGAGGG - Intronic
1035414003 7:158668002-158668024 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414024 7:158668061-158668083 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414034 7:158668090-158668112 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414086 7:158668233-158668255 TAGTGGGTAAGGAGGGCAGAGGG - Intronic
1035414124 7:158668350-158668372 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1038903531 8:31871417-31871439 TAGTGGGAAAGCGAGACTAAGGG - Intronic
1041393905 8:57373045-57373067 CAGAGGGAAAGGAGGGCTAGAGG - Intergenic
1042795885 8:72662753-72662775 GAGTGGGACAGGAGGGCTAATGG + Intronic
1042901500 8:73732808-73732830 TGGTGGGAAAGGAGGGCAGACGG - Intronic
1043723396 8:83577456-83577478 AAGTTGGAACGGATGGGTAATGG + Intergenic
1046032278 8:108797543-108797565 TAGTGGGGAAGGATGGGGAGGGG - Intergenic
1047080194 8:121451860-121451882 TCCTGGGAAAGGATGGGTCAGGG + Intergenic
1050101800 9:2127589-2127611 TAGTGGGTATGGAAGTCTAATGG + Intronic
1050630108 9:7549650-7549672 CAGTGAGAAAGGATGGATCAGGG - Intergenic
1050977733 9:11963381-11963403 TACTGTCAAAGAATGGCTAAAGG - Intergenic
1051470615 9:17436577-17436599 TAGTGTTAAAGGGTTGCTAAAGG - Intronic
1052730694 9:32281719-32281741 GAGTGGGAAATGATGACTAGAGG + Intergenic
1055020133 9:71660561-71660583 GGGTGGGACAGGACGGCTAACGG - Intergenic
1055419069 9:76117397-76117419 GAGTAGGAAAGGATGAATAATGG + Intronic
1055449171 9:76415411-76415433 AGGTGGGACAGGATGGCTAGTGG + Intergenic
1057034911 9:91804974-91804996 CTGTGAGAAAGGAGGGCTAAGGG - Intronic
1057126870 9:92623477-92623499 TAGTGGGAAAAGATACCTACTGG + Intronic
1058133264 9:101277455-101277477 TAGAAGGAAATGATGGCTGAAGG + Intronic
1058161040 9:101571050-101571072 AAGTGGGTGGGGATGGCTAAGGG + Exonic
1058670988 9:107360216-107360238 CAGTGGCAAAGCATGGCCAATGG + Intergenic
1059481374 9:114593191-114593213 AAAGGGGAAAGGATGGATAAGGG + Intronic
1059539698 9:115118219-115118241 AAGTGGGAAAGGATGTCTGGAGG - Exonic
1060363595 9:122985228-122985250 TATTGGGAAAGGAAAGCCAAAGG + Intronic
1188062903 X:25622610-25622632 CAGGAGGAAAGGATGGCCAATGG - Intergenic
1188098303 X:26049588-26049610 GAGTGGTAAAGGCTGGCTAAGGG + Intergenic
1188575602 X:31646206-31646228 CAGTGGGAAAGGAAAGCCAAAGG - Intronic
1188670197 X:32872740-32872762 TAGTGGGCAAAGAAGGATAAGGG + Intronic
1188997151 X:36899448-36899470 AACTGGGAATGGATGGATAACGG + Intergenic
1190787939 X:53671123-53671145 CAGGGGGAAAGGATGGGAAAGGG + Intronic
1191031231 X:55975110-55975132 TAGTGAAAAAGGATGACTAGAGG + Intergenic
1191930681 X:66368031-66368053 TAGAGGCAAATGATGGTTAAAGG - Intergenic
1191960767 X:66699342-66699364 CAGTGGGAAAGGATGGAAATGGG - Intergenic
1192669915 X:73128604-73128626 TGGAGGGAAAGGAAGGCTTATGG + Intergenic
1193091106 X:77494569-77494591 TAGTGAGGAAGGATGGCTCAGGG - Intergenic
1193658651 X:84229350-84229372 TAGTGGGGATGAATGGCTATAGG + Intergenic
1193668059 X:84348751-84348773 AGGTGGGACAAGATGGCTAAAGG + Intronic
1194162405 X:90470218-90470240 TGGTGGGACAGGAAGGCTAGAGG - Intergenic
1194792446 X:98167739-98167761 CAGTGGGAGAGGATGGTGAAAGG + Intergenic
1195919918 X:109973752-109973774 TAGTGTGAAAGGAGGCCTATTGG - Intergenic
1195926580 X:110031758-110031780 TAGGGGGAAAGGAGGGATTAGGG - Intronic
1196218340 X:113081845-113081867 CAGTGGGAAAGGGTGGGAAAAGG - Intergenic
1196510458 X:116504781-116504803 TAATTTGAAAGAATGGCTAAAGG - Intergenic
1197812495 X:130459399-130459421 CAGTGGGAAAGGATTGCTCTTGG + Intergenic
1197830700 X:130639287-130639309 TGGTGGGACAGGATGGCTGAGGG - Intronic
1199795181 X:151188566-151188588 AAGTGAGACAGGAAGGCTAAAGG - Intergenic
1199925314 X:152456680-152456702 TAGTGGGGAGGGATGGTTAATGG + Intergenic
1200354444 X:155533582-155533604 TACTGTGAAGGGATTGCTAATGG + Intronic
1200508684 Y:4047952-4047974 TGGTGGGACAGGAAGGCTAGAGG - Intergenic
1200817805 Y:7552009-7552031 CAGTGGGACATGATGGATAATGG + Intergenic