ID: 1063965754

View in Genome Browser
Species Human (GRCh38)
Location 10:11344633-11344655
Sequence GTCCTTGTGCTGCTTCTCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063965746_1063965754 14 Left 1063965746 10:11344596-11344618 CCCGCGCGGCCGACTCCCTTTTC No data
Right 1063965754 10:11344633-11344655 GTCCTTGTGCTGCTTCTCAGTGG No data
1063965747_1063965754 13 Left 1063965747 10:11344597-11344619 CCGCGCGGCCGACTCCCTTTTCC No data
Right 1063965754 10:11344633-11344655 GTCCTTGTGCTGCTTCTCAGTGG No data
1063965750_1063965754 -2 Left 1063965750 10:11344612-11344634 CCTTTTCCCCTTCACTGCAGCGT No data
Right 1063965754 10:11344633-11344655 GTCCTTGTGCTGCTTCTCAGTGG No data
1063965752_1063965754 -9 Left 1063965752 10:11344619-11344641 CCCTTCACTGCAGCGTCCTTGTG No data
Right 1063965754 10:11344633-11344655 GTCCTTGTGCTGCTTCTCAGTGG No data
1063965753_1063965754 -10 Left 1063965753 10:11344620-11344642 CCTTCACTGCAGCGTCCTTGTGC No data
Right 1063965754 10:11344633-11344655 GTCCTTGTGCTGCTTCTCAGTGG No data
1063965749_1063965754 -1 Left 1063965749 10:11344611-11344633 CCCTTTTCCCCTTCACTGCAGCG No data
Right 1063965754 10:11344633-11344655 GTCCTTGTGCTGCTTCTCAGTGG No data
1063965748_1063965754 5 Left 1063965748 10:11344605-11344627 CCGACTCCCTTTTCCCCTTCACT No data
Right 1063965754 10:11344633-11344655 GTCCTTGTGCTGCTTCTCAGTGG No data
1063965751_1063965754 -8 Left 1063965751 10:11344618-11344640 CCCCTTCACTGCAGCGTCCTTGT No data
Right 1063965754 10:11344633-11344655 GTCCTTGTGCTGCTTCTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063965754 Original CRISPR GTCCTTGTGCTGCTTCTCAG TGG Intergenic
No off target data available for this crispr