ID: 1063966825

View in Genome Browser
Species Human (GRCh38)
Location 10:11352513-11352535
Sequence GGCCAGGTTAATGCAAACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063966821_1063966825 4 Left 1063966821 10:11352486-11352508 CCCACTTTCAATTACATGCAAAT 0: 26
1: 115
2: 189
3: 287
4: 465
Right 1063966825 10:11352513-11352535 GGCCAGGTTAATGCAAACTGAGG No data
1063966822_1063966825 3 Left 1063966822 10:11352487-11352509 CCACTTTCAATTACATGCAAATT 0: 22
1: 98
2: 205
3: 271
4: 495
Right 1063966825 10:11352513-11352535 GGCCAGGTTAATGCAAACTGAGG No data
1063966820_1063966825 13 Left 1063966820 10:11352477-11352499 CCACTTATGCCCACTTTCAATTA No data
Right 1063966825 10:11352513-11352535 GGCCAGGTTAATGCAAACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063966825 Original CRISPR GGCCAGGTTAATGCAAACTG AGG Intergenic
No off target data available for this crispr