ID: 1063967158

View in Genome Browser
Species Human (GRCh38)
Location 10:11355092-11355114
Sequence ATTGGCAGCGTGGTTAGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063967154_1063967158 12 Left 1063967154 10:11355057-11355079 CCTCAAAGAAGTCTCTGAGCAGT No data
Right 1063967158 10:11355092-11355114 ATTGGCAGCGTGGTTAGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063967158 Original CRISPR ATTGGCAGCGTGGTTAGGTG AGG Intergenic