ID: 1063967996

View in Genome Browser
Species Human (GRCh38)
Location 10:11361928-11361950
Sequence CAGCATTAATGGCATCAATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063967996_1063968003 12 Left 1063967996 10:11361928-11361950 CCACATTGATGCCATTAATGCTG No data
Right 1063968003 10:11361963-11361985 TCCTTCTGGAAACCTAGAAATGG No data
1063967996_1063968000 -2 Left 1063967996 10:11361928-11361950 CCACATTGATGCCATTAATGCTG No data
Right 1063968000 10:11361949-11361971 TGGGCTTCTGCCCTTCCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063967996 Original CRISPR CAGCATTAATGGCATCAATG TGG (reversed) Intergenic
No off target data available for this crispr