ID: 1063968003

View in Genome Browser
Species Human (GRCh38)
Location 10:11361963-11361985
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063967996_1063968003 12 Left 1063967996 10:11361928-11361950 CCACATTGATGCCATTAATGCTG No data
Right 1063968003 10:11361963-11361985 TCCTTCTGGAAACCTAGAAATGG No data
1063967999_1063968003 1 Left 1063967999 10:11361939-11361961 CCATTAATGCTGGGCTTCTGCCC No data
Right 1063968003 10:11361963-11361985 TCCTTCTGGAAACCTAGAAATGG No data
1063967994_1063968003 25 Left 1063967994 10:11361915-11361937 CCCATCTGAACTGCCACATTGAT No data
Right 1063968003 10:11361963-11361985 TCCTTCTGGAAACCTAGAAATGG No data
1063967995_1063968003 24 Left 1063967995 10:11361916-11361938 CCATCTGAACTGCCACATTGATG No data
Right 1063968003 10:11361963-11361985 TCCTTCTGGAAACCTAGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063968003 Original CRISPR TCCTTCTGGAAACCTAGAAA TGG Intergenic