ID: 1063968897

View in Genome Browser
Species Human (GRCh38)
Location 10:11367732-11367754
Sequence CTCGGTGCCCACAGGGCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063968885_1063968897 26 Left 1063968885 10:11367683-11367705 CCGGTGCCTCCAGGGAGGGCCAG No data
Right 1063968897 10:11367732-11367754 CTCGGTGCCCACAGGGCACCAGG No data
1063968887_1063968897 20 Left 1063968887 10:11367689-11367711 CCTCCAGGGAGGGCCAGCAGGAG No data
Right 1063968897 10:11367732-11367754 CTCGGTGCCCACAGGGCACCAGG No data
1063968889_1063968897 17 Left 1063968889 10:11367692-11367714 CCAGGGAGGGCCAGCAGGAGGCG No data
Right 1063968897 10:11367732-11367754 CTCGGTGCCCACAGGGCACCAGG No data
1063968893_1063968897 7 Left 1063968893 10:11367702-11367724 CCAGCAGGAGGCGCTGGGGACAA No data
Right 1063968897 10:11367732-11367754 CTCGGTGCCCACAGGGCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063968897 Original CRISPR CTCGGTGCCCACAGGGCACC AGG Intergenic
No off target data available for this crispr