ID: 1063970716

View in Genome Browser
Species Human (GRCh38)
Location 10:11379597-11379619
Sequence CACGAAAACGTGCATCCGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063970711_1063970716 16 Left 1063970711 10:11379558-11379580 CCCCAAACATTTTCTAAGGACTT No data
Right 1063970716 10:11379597-11379619 CACGAAAACGTGCATCCGGCCGG No data
1063970712_1063970716 15 Left 1063970712 10:11379559-11379581 CCCAAACATTTTCTAAGGACTTG No data
Right 1063970716 10:11379597-11379619 CACGAAAACGTGCATCCGGCCGG No data
1063970713_1063970716 14 Left 1063970713 10:11379560-11379582 CCAAACATTTTCTAAGGACTTGA No data
Right 1063970716 10:11379597-11379619 CACGAAAACGTGCATCCGGCCGG No data
1063970710_1063970716 17 Left 1063970710 10:11379557-11379579 CCCCCAAACATTTTCTAAGGACT No data
Right 1063970716 10:11379597-11379619 CACGAAAACGTGCATCCGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063970716 Original CRISPR CACGAAAACGTGCATCCGGC CGG Intergenic
No off target data available for this crispr