ID: 1063971928

View in Genome Browser
Species Human (GRCh38)
Location 10:11387217-11387239
Sequence TCCCACGGCGCTGGGGCCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063971920_1063971928 10 Left 1063971920 10:11387184-11387206 CCCACGTAGGTGCAGGATCAAGA No data
Right 1063971928 10:11387217-11387239 TCCCACGGCGCTGGGGCCGGAGG No data
1063971921_1063971928 9 Left 1063971921 10:11387185-11387207 CCACGTAGGTGCAGGATCAAGAC No data
Right 1063971928 10:11387217-11387239 TCCCACGGCGCTGGGGCCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063971928 Original CRISPR TCCCACGGCGCTGGGGCCGG AGG Intergenic
No off target data available for this crispr