ID: 1063975009

View in Genome Browser
Species Human (GRCh38)
Location 10:11408091-11408113
Sequence TGGGTTCACACACAGAGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063975005_1063975009 -7 Left 1063975005 10:11408075-11408097 CCACTCATCATGTAAATGGGTTC No data
Right 1063975009 10:11408091-11408113 TGGGTTCACACACAGAGGGTGGG No data
1063975002_1063975009 1 Left 1063975002 10:11408067-11408089 CCTTCATTCCACTCATCATGTAA No data
Right 1063975009 10:11408091-11408113 TGGGTTCACACACAGAGGGTGGG No data
1063975000_1063975009 20 Left 1063975000 10:11408048-11408070 CCTTTGCTGTGATCAGCCACCTT No data
Right 1063975009 10:11408091-11408113 TGGGTTCACACACAGAGGGTGGG No data
1063975001_1063975009 4 Left 1063975001 10:11408064-11408086 CCACCTTCATTCCACTCATCATG No data
Right 1063975009 10:11408091-11408113 TGGGTTCACACACAGAGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063975009 Original CRISPR TGGGTTCACACACAGAGGGT GGG Intergenic
No off target data available for this crispr