ID: 1063979596

View in Genome Browser
Species Human (GRCh38)
Location 10:11443003-11443025
Sequence ATGGAAACACAGGTCAAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063979590_1063979596 7 Left 1063979590 10:11442973-11442995 CCACCGGAGCACTCTTCACCCAA No data
Right 1063979596 10:11443003-11443025 ATGGAAACACAGGTCAAATAAGG No data
1063979591_1063979596 4 Left 1063979591 10:11442976-11442998 CCGGAGCACTCTTCACCCAAGAA No data
Right 1063979596 10:11443003-11443025 ATGGAAACACAGGTCAAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063979596 Original CRISPR ATGGAAACACAGGTCAAATA AGG Intergenic
No off target data available for this crispr