ID: 1063980537

View in Genome Browser
Species Human (GRCh38)
Location 10:11448254-11448276
Sequence GTGAAATAAACGAAGTCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063980535_1063980537 -6 Left 1063980535 10:11448237-11448259 CCAAAGGTTCTAAGCCTGTGAAA No data
Right 1063980537 10:11448254-11448276 GTGAAATAAACGAAGTCTGCTGG No data
1063980530_1063980537 15 Left 1063980530 10:11448216-11448238 CCAACAGCCAGACCAGAGCCTCC No data
Right 1063980537 10:11448254-11448276 GTGAAATAAACGAAGTCTGCTGG No data
1063980532_1063980537 8 Left 1063980532 10:11448223-11448245 CCAGACCAGAGCCTCCAAAGGTT No data
Right 1063980537 10:11448254-11448276 GTGAAATAAACGAAGTCTGCTGG No data
1063980534_1063980537 -3 Left 1063980534 10:11448234-11448256 CCTCCAAAGGTTCTAAGCCTGTG No data
Right 1063980537 10:11448254-11448276 GTGAAATAAACGAAGTCTGCTGG No data
1063980533_1063980537 3 Left 1063980533 10:11448228-11448250 CCAGAGCCTCCAAAGGTTCTAAG No data
Right 1063980537 10:11448254-11448276 GTGAAATAAACGAAGTCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063980537 Original CRISPR GTGAAATAAACGAAGTCTGC TGG Intergenic
No off target data available for this crispr