ID: 1063981353

View in Genome Browser
Species Human (GRCh38)
Location 10:11454466-11454488
Sequence CATGTGACCCAGGAGGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 480
Summary {0: 1, 1: 0, 2: 5, 3: 39, 4: 435}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063981353_1063981359 3 Left 1063981353 10:11454466-11454488 CCTCCTCCCTCCTGGGTCACATG 0: 1
1: 0
2: 5
3: 39
4: 435
Right 1063981359 10:11454492-11454514 CCTTACTGTGTCTTTACCTCTGG 0: 1
1: 0
2: 0
3: 10
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063981353 Original CRISPR CATGTGACCCAGGAGGGAGG AGG (reversed) Intronic
900482467 1:2905743-2905765 CATGGCTCCCAGGAGGGTGGGGG - Intergenic
901006019 1:6171870-6171892 CAGGTGGGCCAGGAGGGTGGTGG - Intronic
901175069 1:7293054-7293076 CCAGTGACCCAGCAGGGAGTAGG - Intronic
902692348 1:18117796-18117818 CATCTGAGCCAGAAGGGAGCTGG + Intronic
902833989 1:19035059-19035081 CACTTGCCCCAGGAGGGAGCCGG + Intergenic
903019324 1:20382933-20382955 CATTACACCCAGGAGGGCGGCGG + Intergenic
903213263 1:21830124-21830146 GAGGTGACTCTGGAGGGAGGGGG + Intronic
903291115 1:22314906-22314928 CATGTGACGATGGAGGGAGACGG + Intergenic
903537643 1:24077496-24077518 GGAGTGAGCCAGGAGGGAGGCGG - Intronic
904343930 1:29856036-29856058 GATGGGGCCCAGGAGGGAGGAGG - Intergenic
904450239 1:30606299-30606321 GATGGGGCCCAGGAGGGAGGAGG + Intergenic
904665432 1:32117254-32117276 CATTTGAACCCGGAGGGTGGAGG - Intronic
904690782 1:32292082-32292104 CGTCCGACCCAGGGGGGAGGGGG - Exonic
905103028 1:35542101-35542123 CAGATGACCCAGCAGGCAGGAGG - Intronic
905206666 1:36346548-36346570 CTTCTAACCCAGGAGGGAGGAGG + Intronic
905293452 1:36939202-36939224 CATGTGCCCCCAGAGGGAGCGGG + Intronic
905937777 1:41838510-41838532 AATGTGGCTCAGGAGGGAAGGGG - Intronic
907182889 1:52586378-52586400 AAAGTGTCCCAAGAGGGAGGGGG + Intergenic
907267507 1:53271817-53271839 CAGCTGCCCCAGGAGGGAAGTGG - Intronic
909118374 1:71568998-71569020 CATGTGAACCTGGAAGGTGGAGG - Intronic
909987810 1:82184021-82184043 CTTGCTACCCAGGAGGGAGAGGG + Intergenic
910895254 1:92062499-92062521 CATTTGAACCCGGAGGGTGGAGG + Intronic
911325094 1:96462031-96462053 CATAGAACCCAGGAGGGAAGAGG - Intergenic
911617660 1:100032627-100032649 CATTTGAACCCGGAGGGTGGAGG - Intergenic
912395087 1:109336300-109336322 CTTTTGACCAAGGAGGAAGGTGG - Exonic
912500065 1:110115738-110115760 CAGGTGACCCAGGAAGAAGCTGG - Intergenic
912504611 1:110147773-110147795 CATGGGACCCAGGGGACAGGTGG + Intergenic
914252610 1:145934241-145934263 TATGTCACCCAGGAGAGAAGTGG + Exonic
914872039 1:151482993-151483015 CATTTGAACCCGGAGGGTGGAGG + Intergenic
915135556 1:153728717-153728739 CAGGAGCCCCAGGAGGGGGGAGG + Exonic
915367876 1:155325488-155325510 CAGGTGAGCCAGGAGGGCGTGGG + Exonic
915480100 1:156178583-156178605 CAGGCGACACTGGAGGGAGGTGG - Intergenic
918139104 1:181705232-181705254 CATGTGTGCCTGGAGGGATGAGG - Intronic
919173757 1:193992574-193992596 CACGTGAACCTGGAAGGAGGAGG - Intergenic
919597333 1:199580472-199580494 CATGTTACCCAGCAGCCAGGAGG + Intergenic
919771014 1:201158598-201158620 AATGTGAGCCAGGAGGGAGCCGG + Intronic
919910688 1:202108905-202108927 TTTCTGACCCAGGAGGGTGGAGG - Intergenic
920054671 1:203183446-203183468 CTTGTGACCATGGTGGGAGGTGG - Intronic
920271890 1:204771476-204771498 CTAGTGAACCAGGAGGTAGGAGG - Intergenic
920348879 1:205324421-205324443 TATGTATCCCAGGTGGGAGGAGG + Intergenic
921283502 1:213589076-213589098 CAGGTGACTCACCAGGGAGGGGG - Intergenic
922190735 1:223316448-223316470 CATGGGAACCTGGAGGAAGGGGG + Intronic
922233547 1:223706287-223706309 GATGCCACTCAGGAGGGAGGGGG - Intronic
923537189 1:234862444-234862466 AATGTGACCCCGGAGGGATGGGG + Intergenic
923719158 1:236452374-236452396 CATGTGTCTTAGGAGGGAGCTGG + Intronic
923852541 1:237813128-237813150 CCTGTGACCCTGAAGGCAGGAGG + Intronic
1062934393 10:1375093-1375115 CATGGGACTCAGGAAGGAGCAGG + Intronic
1063108790 10:3017319-3017341 CATTTGAGCCAGGAAGGTGGAGG + Intergenic
1063368246 10:5504418-5504440 CATGTCACCCAGCAGAGAGCTGG - Intergenic
1063981353 10:11454466-11454488 CATGTGACCCAGGAGGGAGGAGG - Intronic
1064751121 10:18530121-18530143 CATGTGTCACAGGAGGGACCTGG - Intronic
1064756897 10:18579618-18579640 CATGTGCCCCAGGTGGTTGGGGG + Intronic
1065786080 10:29216452-29216474 CATGTGTCAAGGGAGGGAGGTGG + Intergenic
1066260479 10:33724956-33724978 CTTCTGAGGCAGGAGGGAGGAGG - Intergenic
1066345491 10:34581316-34581338 CATTTGAACCTGGAGGGTGGAGG - Intronic
1068265133 10:54638089-54638111 AATGTGACACAGGGTGGAGGGGG - Intronic
1068517371 10:58041008-58041030 CATGTGTCAAAGGAGGGAGGTGG - Intergenic
1068707341 10:60091515-60091537 AATGTGACCAGGGAGGGTGGGGG + Intronic
1070175447 10:73965802-73965824 TGTCTGAACCAGGAGGGAGGGGG - Intergenic
1070789382 10:79180466-79180488 CATGGGACAGAGGAGGCAGGTGG - Intronic
1071472121 10:85991079-85991101 CCTCTGACCCATGAGGGAAGGGG + Intronic
1071520564 10:86329427-86329449 CATGGAAGCCAGGAGGAAGGGGG + Intronic
1072022025 10:91411134-91411156 CATGTGACTCAGGTGGGGGGAGG + Intronic
1072232487 10:93425288-93425310 CATGTGTCCCAGGAAGGGAGGGG - Intronic
1072421839 10:95295978-95296000 AATGGGAACCAGGAGGCAGGTGG - Intergenic
1073045908 10:100638038-100638060 AATGTGAGGCAGGAGGGAGGTGG + Intergenic
1074411992 10:113236393-113236415 CATGTGACCCCGTAGGGTCGCGG + Intergenic
1075516238 10:123110739-123110761 CATGTCACCCAGGAGGGCCTAGG + Intergenic
1075684462 10:124353997-124354019 CAAGGGACCCAGGAGGGAGATGG - Intergenic
1076798679 10:132810865-132810887 CGTGGGACCCACAAGGGAGGAGG - Intronic
1076839413 10:133038717-133038739 GAGGTGACCCAGGAGGGAGGTGG - Intergenic
1076903341 10:133350538-133350560 CATGTGACCCAGGTGGAGGAGGG + Intronic
1076915504 10:133421470-133421492 CATTTCCCCCAGGAGGCAGGGGG - Exonic
1077026954 11:444259-444281 CATTTGAACCCGGAGGGTGGAGG + Intergenic
1077147407 11:1052342-1052364 CAGGTGCCCCAGGAGGGGGAGGG - Intergenic
1077481743 11:2818215-2818237 CAGGTGACCCAAGAGTGTGGGGG + Intronic
1078989055 11:16626966-16626988 AATGTGAGACGGGAGGGAGGTGG - Intronic
1079035360 11:17015069-17015091 GATGTGAAACAGGAGGGAGCAGG + Intergenic
1079039824 11:17050597-17050619 CATGCCATCCGGGAGGGAGGTGG - Intergenic
1079088578 11:17464814-17464836 CATCTGGTCTAGGAGGGAGGAGG - Intronic
1079764298 11:24371478-24371500 CACTTGAGCCTGGAGGGAGGAGG - Intergenic
1079990162 11:27238099-27238121 CAAGGGACCCAGAAGAGAGGTGG - Intergenic
1080444908 11:32329354-32329376 CATGTCGGCCAGGATGGAGGTGG - Intergenic
1081536733 11:44002158-44002180 CACGTAACACAGGAGGAAGGAGG - Intergenic
1081813528 11:45926420-45926442 CCTGGGACCCAGGAGGGTGTTGG - Exonic
1082096095 11:48130554-48130576 CATATCACACAGGAGGGAGCTGG + Exonic
1082795815 11:57377038-57377060 AATGTGAGCCAGTAGGGATGTGG - Intronic
1082814200 11:57497596-57497618 GCTGTGGCCCAGGAGAGAGGGGG + Intronic
1083724869 11:64622843-64622865 CATGTCAGCCAGCAGGGTGGTGG + Exonic
1083752360 11:64767586-64767608 CATGGTGCCCAGGAGGGTGGGGG + Exonic
1083857745 11:65401404-65401426 GATGTGACCCAAGTGGGAGAGGG - Intronic
1084203339 11:67576792-67576814 CATGTGTTCAAGGAGGAAGGTGG + Intergenic
1084399906 11:68937435-68937457 CATGTGGCCCTGGAGGGTGGAGG + Intronic
1084455551 11:69266134-69266156 CATGTGAGGGAGGAGGGAGGGGG + Intergenic
1084591717 11:70094249-70094271 CAGGTGACCAGGGAGGGTGGTGG + Intronic
1085228163 11:74941494-74941516 AATGTGACCCAAGAAGGAGAGGG + Intronic
1085311770 11:75521054-75521076 TTCGTGACCCTGGAGGGAGGAGG - Intronic
1085514867 11:77106143-77106165 TGTGTGACCCAGGAGAGTGGTGG - Intronic
1085522342 11:77146037-77146059 GATGTGGCCCTGGAGGCAGGGGG + Intronic
1085873048 11:80372973-80372995 CATGTGACCCACATGGGAAGAGG - Intergenic
1087173198 11:95071645-95071667 CAGGTGACCCAATAGGAAGGTGG - Intergenic
1087269843 11:96100025-96100047 CATGTGAACCAGAAGTGAAGGGG + Intronic
1088930172 11:114343169-114343191 CATGTGACCCATGAGATAGCAGG - Intergenic
1089391995 11:118108570-118108592 CCTGGGACCCAAGAGGGAAGAGG - Intronic
1089810296 11:121125963-121125985 CTTGTGACCCAAGAATGAGGGGG + Intronic
1089871021 11:121672760-121672782 CAGATGACCAGGGAGGGAGGGGG + Intergenic
1090399694 11:126441144-126441166 CCTGAGACACAGGTGGGAGGAGG - Intronic
1090831669 11:130424887-130424909 CATGAGACCCAGGGTGGAGGTGG + Intronic
1091181170 11:133605875-133605897 GGAGTGACCCAGGAGGGAGCAGG - Intergenic
1091651690 12:2315112-2315134 AGTGTGACCCGGGAGAGAGGAGG - Intronic
1091664129 12:2406917-2406939 CCACTGACCCAGCAGGGAGGAGG + Intronic
1092007447 12:5081254-5081276 CTGGTGACCCAGCAGGGCGGAGG + Intergenic
1094476659 12:30845716-30845738 CGTATGACCCAGGGTGGAGGAGG - Intergenic
1096980541 12:55726044-55726066 CAAGAGACCCAGGATGGAGGTGG - Intronic
1097492804 12:60291439-60291461 CATGTGTCCAAGGAGGGACCTGG + Intergenic
1098591521 12:72219541-72219563 CATGTGACCCAGGATGGGAAAGG - Intronic
1098805454 12:75016148-75016170 AATGAGAGCCAGGTGGGAGGGGG - Intergenic
1100700670 12:97144483-97144505 AATGTGACCTAGGAGAGAGCAGG - Intergenic
1102547021 12:113664568-113664590 CAGGGGAGCCAGGAGGGAAGGGG - Intergenic
1102687942 12:114738886-114738908 CATGTGACTCAGGAGAGAGCTGG - Intergenic
1103024652 12:117563776-117563798 CATGCCACCCATGAGAGAGGGGG - Intronic
1103318693 12:120077506-120077528 CCTGTCACCCAGGTGGCAGGAGG + Intronic
1103890138 12:124232354-124232376 CAGGGGCCCCAGGTGGGAGGTGG - Intronic
1104082555 12:125443221-125443243 CAGGAGACCCAGGTGTGAGGTGG + Intronic
1104558965 12:129826508-129826530 CTTGTGTCCCAGGAGCAAGGCGG - Intronic
1105013979 12:132774765-132774787 CATGTTTTCCAGGAGGCAGGTGG - Intronic
1106581927 13:31026224-31026246 CAGCTGCCCCAGGAGAGAGGAGG - Intergenic
1106927691 13:34630826-34630848 GATATGCTCCAGGAGGGAGGAGG - Intergenic
1107398811 13:40048429-40048451 CATGTGCCAGAGAAGGGAGGTGG + Intergenic
1107711117 13:43151502-43151524 CATGTGGCTCTGGAGGGAGCAGG + Intergenic
1108120409 13:47179624-47179646 CATATGACCCAGGAGTTAAGTGG - Intergenic
1108581440 13:51831673-51831695 CAGATGCCCCAGGAGGCAGGGGG - Intergenic
1108698118 13:52920739-52920761 TGTGTGACCCCGGAGGTAGGGGG + Intergenic
1109409405 13:61943586-61943608 CCCATGACCCAGGAGGGAAGAGG - Intergenic
1111975494 13:94962686-94962708 CATGTTACAGATGAGGGAGGGGG + Intergenic
1113078355 13:106491053-106491075 CTTGTTTCCCAGAAGGGAGGGGG + Exonic
1113337422 13:109390601-109390623 CATTTGCTCCAGCAGGGAGGAGG - Intergenic
1113954422 13:114089550-114089572 CCGGTGACCCAGGAAGCAGGAGG + Intronic
1119545924 14:75471365-75471387 CATGTCACGCATGAGGAAGGCGG + Intronic
1120311820 14:82838371-82838393 CATGTCAGCCAGCAGGGAAGTGG - Intergenic
1121001370 14:90454153-90454175 CCTGGTACCCAGGAGGGAGGAGG - Intergenic
1121612683 14:95292459-95292481 CCTGTGACCCAAGATGCAGGGGG - Intronic
1122662381 14:103305982-103306004 CATTTGAGCCAGGGAGGAGGAGG + Intergenic
1202848450 14_GL000225v1_random:1111-1133 AAGGTGACCCACGAGGGAGCAGG - Intergenic
1202859538 14_GL000225v1_random:72691-72713 AAGGCGACCCACGAGGGAGGAGG + Intergenic
1125023669 15:35009342-35009364 CATTTGAACCCGGAGGGTGGAGG - Intergenic
1125119216 15:36133232-36133254 CATGTGACCCAGAAGAGACCTGG - Intergenic
1125444244 15:39736607-39736629 CCTGTGGCCCACGGGGGAGGAGG - Intronic
1126133796 15:45370855-45370877 CATTTGAACCTGGTGGGAGGCGG - Intronic
1127734838 15:61830869-61830891 CATCTGACTCTGCAGGGAGGTGG + Intergenic
1128329503 15:66746322-66746344 CATGCCCCACAGGAGGGAGGAGG - Intronic
1128563766 15:68685595-68685617 CAGGTGCTCCAGGAGGCAGGAGG + Intronic
1128667988 15:69552692-69552714 CAGATGCCCCAGGAGAGAGGAGG + Intergenic
1129224989 15:74164145-74164167 CATGTGACCCATTAGGCTGGGGG - Intergenic
1129688492 15:77699927-77699949 CATTGGACCCAGTAGGGAAGGGG + Intronic
1130964354 15:88686010-88686032 CTTGGGATCCAGGAGGGATGTGG + Intergenic
1131107373 15:89744231-89744253 TATGTGACCCAGGGAGGAGGTGG - Intergenic
1131120579 15:89820954-89820976 CATGTGCCCCAGGACTGTGGGGG - Intergenic
1132626904 16:895513-895535 CATGTGACCGAGAAGGCAGCAGG + Intronic
1132807723 16:1782757-1782779 CATTGGACCCGGGTGGGAGGTGG + Exonic
1133020489 16:2964772-2964794 CTGGGGACCCAGGCGGGAGGTGG + Intronic
1133332311 16:4982233-4982255 CCTGGGAGCCAGGAGGGAAGGGG + Intronic
1133464205 16:6014554-6014576 CATGTGCCCAAGGACTGAGGGGG + Intergenic
1133950535 16:10387984-10388006 CACTTGAACCCGGAGGGAGGAGG - Intronic
1135591857 16:23710873-23710895 TATGGGCCCAAGGAGGGAGGAGG + Intronic
1136557795 16:31018433-31018455 CAGGTGATGAAGGAGGGAGGAGG + Intergenic
1136984316 16:35084802-35084824 TCTGGCACCCAGGAGGGAGGGGG - Intergenic
1137286205 16:47017782-47017804 CAGATGGCCCAGGTGGGAGGCGG + Intergenic
1137433295 16:48435502-48435524 CCTGGGACCCAGGAAGGAGGAGG + Intronic
1137445517 16:48529570-48529592 CATGTGGCCATGGAGGGAGGAGG - Intergenic
1138252176 16:55509528-55509550 CATGGGTCTGAGGAGGGAGGTGG + Intronic
1139166218 16:64567498-64567520 CATGTGTCACGGGAGGGAAGAGG + Intergenic
1139506046 16:67398595-67398617 CAGGTGCCCCAGGAGGGCTGTGG + Exonic
1139563057 16:67755982-67756004 CATTTGAACCAGCAGGCAGGAGG + Intronic
1139972296 16:70783675-70783697 CAGGTGTCCCATGTGGGAGGAGG + Intronic
1141369151 16:83471356-83471378 CATTTGAACCCGGAGGGTGGAGG - Intronic
1141515877 16:84544650-84544672 CATCTGACAGAGGAGGCAGGCGG + Intronic
1141516444 16:84548199-84548221 CATGTCACATAGGAGGGGGGGGG + Intronic
1141753394 16:85974971-85974993 CCTGAGTCCCAGGAAGGAGGTGG - Intergenic
1142203750 16:88773148-88773170 AATGAGACCCAGGAGGAAGGAGG - Intronic
1142246060 16:88970594-88970616 CCTGTGGCCCCGGAGGGAAGGGG - Intronic
1142359806 16:89620690-89620712 CTTGTGACCTGGGAGGCAGGAGG + Exonic
1142646396 17:1316322-1316344 AAAGTCACCCAGGAGGGAGAAGG - Intergenic
1143070263 17:4285981-4286003 AAAGGGACCCAGGAGAGAGGTGG + Intronic
1143109137 17:4543789-4543811 CAGAGGGCCCAGGAGGGAGGCGG - Intronic
1143111757 17:4556759-4556781 CTGGTGCCCCAGGAGGCAGGAGG + Intergenic
1143371255 17:6441486-6441508 GATGAGACCCAGGAGGTAGTTGG + Intergenic
1143552031 17:7636272-7636294 AGTGTGAGCCAGCAGGGAGGGGG + Intergenic
1143570231 17:7753532-7753554 CATGGGACACTGGAGAGAGGAGG + Intronic
1144307883 17:13985717-13985739 GATGTGATCAAGGAGGGAAGAGG - Intergenic
1145275962 17:21430660-21430682 CATGTGACCACGGAGGCAGAGGG + Intergenic
1145313808 17:21716573-21716595 CATGTGACCATGGAGGCAGAGGG + Intergenic
1145712250 17:26988547-26988569 CATGTGACCATGGAGGCAGAGGG + Intergenic
1146547025 17:33748661-33748683 CATGTGGCCCAGAAGGTGGGAGG - Intronic
1146821834 17:35989631-35989653 TCTGTCACCCAGGAGTGAGGTGG + Intronic
1147685412 17:42284046-42284068 CATGGGAGCCAGAGGGGAGGTGG - Intergenic
1147840643 17:43369060-43369082 GAGGTGACCCAGGAGGGGGTAGG + Intergenic
1148211698 17:45812776-45812798 CAAGTGGGCCAGGAGAGAGGTGG - Intronic
1148326075 17:46784188-46784210 CATGAGAAACAGGAGGAAGGAGG + Intronic
1148543850 17:48501979-48502001 CACCTGTCTCAGGAGGGAGGTGG + Intergenic
1149595324 17:57861809-57861831 CCTGGGGCCCTGGAGGGAGGGGG - Exonic
1150230365 17:63546322-63546344 CAGGTGACCCAGGATGGCGTGGG + Exonic
1151529027 17:74692534-74692556 CCGGTGACCCAGCAGGTAGGAGG - Intronic
1152332593 17:79681722-79681744 CATGTGAGCCAGAAAGGAGTGGG + Intergenic
1152382881 17:79951367-79951389 CACAGGACCCAGGAGGGAGATGG + Intronic
1152401478 17:80069072-80069094 CATGGGTGTCAGGAGGGAGGAGG - Intronic
1152459309 17:80432906-80432928 CCTTTGACTCAGGAGGTAGGTGG - Intronic
1152743733 17:82029873-82029895 GGTGTGACCGAAGAGGGAGGAGG + Intronic
1154302638 18:13207759-13207781 CAGTTGACCCTGGAGGGTGGTGG - Intergenic
1155078417 18:22383474-22383496 AATATGACCCATGAGGGTGGCGG + Intergenic
1155457893 18:26040456-26040478 CATGTCACTCAAGGGGGAGGAGG - Intronic
1156223322 18:35076485-35076507 CATCTGACTTAAGAGGGAGGGGG - Intronic
1157280743 18:46344953-46344975 CATGTCCCTCAGGACGGAGGGGG + Intronic
1157292676 18:46421108-46421130 GAGGAGACCCAGGACGGAGGTGG - Intronic
1157744922 18:50127051-50127073 CATAAGACCCAAGAGGCAGGTGG + Intronic
1158249867 18:55475843-55475865 CCTGTGACCTAGGTGGGAGTGGG + Intronic
1160702151 19:512838-512860 CAACCCACCCAGGAGGGAGGGGG - Intronic
1160732856 19:649141-649163 CAGGGGACCCAGGAGCGGGGGGG - Intronic
1160797834 19:953965-953987 CAGGAGACCGAGGTGGGAGGTGG + Intronic
1161241665 19:3226505-3226527 CATGTGGCCTAGGAGGGCAGAGG + Intronic
1161488863 19:4550769-4550791 CATGTGACTCAGGATGGAGGGGG + Intronic
1161968685 19:7563191-7563213 CTTGTGAGCCAGGATGGAAGGGG - Intergenic
1162369028 19:10268077-10268099 GATGTGGCCCAGGATGGAGTAGG + Intergenic
1162431576 19:10631949-10631971 CATGTAAGTCAGGAGGGAAGGGG + Exonic
1163008673 19:14411562-14411584 CATGTGCCACACGAGGGAGCTGG - Exonic
1163389454 19:17021575-17021597 CATTTGACCAAGGAGTGAAGGGG + Intronic
1163491295 19:17618493-17618515 CATGTGATCCTGGATGGATGGGG + Exonic
1163561787 19:18023606-18023628 CCTGTGACCCAGGAGGGACCAGG + Intergenic
1163586641 19:18168000-18168022 CCTGAGGCCCAAGAGGGAGGTGG - Intronic
1163718424 19:18885986-18886008 CAGGTGCACCAGGAGGCAGGAGG - Intronic
1163918839 19:20268640-20268662 CATTTGAACCTGGAGGGTGGAGG + Intergenic
1164160336 19:22622236-22622258 CACGTGACCAAGGAGGTTGGGGG - Intergenic
1164803594 19:31098698-31098720 CATGGGAACCAGGAGGAAGCAGG - Intergenic
1165017667 19:32894081-32894103 CCAGTGACGCAGGAGGCAGGAGG + Intronic
1165956568 19:39505028-39505050 CATGTGACCCCAGAGGGAGGAGG - Intronic
1165994857 19:39836806-39836828 CTTGGGACACTGGAGGGAGGGGG - Intronic
1166182128 19:41116490-41116512 CCTGGGACCCAGGCGGGTGGTGG + Exonic
1167088278 19:47325207-47325229 ACTGTGAGCCAGGAGGCAGGAGG + Intergenic
1167116292 19:47491112-47491134 CAGCTGAGCCAGGTGGGAGGAGG - Intronic
925296741 2:2782075-2782097 CAAGTCACCTGGGAGGGAGGCGG - Intergenic
925911198 2:8574657-8574679 CCTGTGTCCAAGGAGGAAGGCGG + Intergenic
926041216 2:9674716-9674738 CATGCTTCCCAGAAGGGAGGAGG + Intergenic
926641653 2:15244329-15244351 CATGTGGCCCAGGAAGGAAGTGG + Intronic
926744526 2:16139787-16139809 CATGTGAGGGAGTAGGGAGGTGG - Intergenic
927000467 2:18789461-18789483 CATGTGTCACAGGAGGAAGCTGG + Intergenic
927089951 2:19702883-19702905 CATGAGGGCCAGCAGGGAGGGGG + Intergenic
927358169 2:22199027-22199049 CAAGTGACAAAAGAGGGAGGGGG - Intergenic
928129930 2:28642064-28642086 CATCTGGACCTGGAGGGAGGCGG - Intronic
928244463 2:29615192-29615214 CATGTAACCAAGTAGGAAGGAGG - Intronic
928494404 2:31817450-31817472 CAAGTGGGCAAGGAGGGAGGTGG - Intergenic
931217457 2:60260003-60260025 CAGGAGACCCAGGAGGAAGCTGG - Intergenic
932745199 2:74328280-74328302 CATGTGACCAAGGTGGGGGGAGG + Intronic
932821285 2:74903388-74903410 CATTTGAACCCGGAGGGTGGAGG - Intergenic
936668763 2:114631107-114631129 AATGTGACCAAGATGGGAGGTGG + Intronic
936726022 2:115316983-115317005 CATGCTACTCAGGAGGCAGGAGG + Intronic
937011467 2:118566553-118566575 CATGTGACAGAGGAAGAAGGAGG + Intergenic
937066972 2:119024653-119024675 CAAGTGAACAAGCAGGGAGGGGG + Intergenic
938378858 2:130825582-130825604 CCTCTCACCCAGGAGGGAGAAGG + Intergenic
941197375 2:162469427-162469449 CATGTGACAAAGGAAGCAGGAGG + Intronic
942535781 2:176961894-176961916 AGGGTGGCCCAGGAGGGAGGAGG + Intergenic
942944410 2:181657127-181657149 GCAGGGACCCAGGAGGGAGGCGG + Intronic
943471445 2:188299166-188299188 CAGGTGACTAAGGAGGGAGCAGG + Intronic
943471452 2:188299214-188299236 CAGGTGACTAAGGAGGGAGCAGG + Intronic
945115086 2:206401276-206401298 CATGCCATCCGGGAGGGAGGTGG - Intergenic
947306476 2:228753924-228753946 CATGTGTCCAGGGAGGGAAGTGG - Intergenic
947742150 2:232489579-232489601 GAGCTGACCCGGGAGGGAGGAGG - Intergenic
947855259 2:233319637-233319659 CAGGGCACCCAGGAGGAAGGTGG - Intronic
948534515 2:238636017-238636039 CAGATGTCCCAGGAGGGTGGTGG + Intergenic
1170337980 20:15292358-15292380 CATATGACCCAGTCTGGAGGAGG + Intronic
1170571336 20:17634478-17634500 CAAGTGACCTAGGAGGGAGGCGG + Intronic
1170827705 20:19810449-19810471 CAGGGCCCCCAGGAGGGAGGTGG + Intergenic
1172141256 20:32724121-32724143 CGTGCCATCCAGGAGGGAGGTGG + Intronic
1174149220 20:48474377-48474399 CATGAGACCCAGGAAGGAGCTGG - Intergenic
1174452646 20:50629431-50629453 CATGAGGCCCTGGAGCGAGGGGG + Intronic
1175326842 20:58135492-58135514 CAGGTAAGCCAGCAGGGAGGCGG + Intergenic
1175581257 20:60101777-60101799 CCTCTCACCGAGGAGGGAGGCGG - Intergenic
1175786305 20:61713712-61713734 CATGTGAGCAGCGAGGGAGGGGG + Intronic
1176188640 20:63795780-63795802 CAGCTGACCCAGGGAGGAGGAGG - Intronic
1177577321 21:22975486-22975508 CATGTGTCACAGGAGGGACCTGG - Intergenic
1178131357 21:29575746-29575768 CATTTGAACCCGGAGGGTGGAGG + Intronic
1178401033 21:32284683-32284705 CATTTGAACCTGGAGGGTGGAGG + Intergenic
1179534674 21:42043909-42043931 CATTTCACCCAGGAGGAAGCTGG + Intergenic
1179937159 21:44613083-44613105 CAGGGGACCCAGCAGGCAGGTGG - Intronic
1179960513 21:44764870-44764892 CATGTGTGCCAGGAGGGAAGGGG - Intergenic
1181442106 22:22941967-22941989 CAGCTGCCCCAGGAGGCAGGGGG + Intergenic
1181967358 22:26666600-26666622 AATGTGACCCAGGAGAAAGTAGG - Intergenic
1182024809 22:27109731-27109753 CATGTGACATAGGAGGGACCCGG - Intergenic
1182166459 22:28179241-28179263 CATGTGACCCTGGGAGGCGGAGG - Intronic
1182321309 22:29480045-29480067 CAGGGGACCGAGGAGGGAAGGGG - Intergenic
1183063771 22:35350224-35350246 CAGGGGAGCCAGGAGGGAGAGGG - Intergenic
1183322877 22:37175885-37175907 CAGGTGTCCCAAGAGGGATGAGG + Intergenic
1183670645 22:39270471-39270493 CTTCTGGCCAAGGAGGGAGGGGG + Intergenic
1184602549 22:45552177-45552199 CGTGTGTGCTAGGAGGGAGGAGG + Intronic
1185065418 22:48629491-48629513 CAGGGGACACAGGAAGGAGGTGG - Intronic
1185207410 22:49548051-49548073 TGTGGGACCCTGGAGGGAGGCGG - Intronic
1185394524 22:50579917-50579939 CCTGTGAGGAAGGAGGGAGGTGG - Intronic
949352445 3:3138146-3138168 CATGGGACCCAGGAAACAGGAGG - Intronic
950941892 3:16901314-16901336 CATGTGACCCAGTGGGGAGCTGG + Intronic
951531936 3:23706060-23706082 CTAGCTACCCAGGAGGGAGGTGG + Intergenic
953351778 3:42221476-42221498 CGTGTTTCCCACGAGGGAGGGGG + Intronic
953648738 3:44779748-44779770 CATTTGAACCCGGAGGGTGGAGG + Intronic
953928785 3:46995865-46995887 CATGTGGCCCAGTAGAGAGAGGG + Intronic
954003585 3:47576540-47576562 CATTTGAACCCGGAGGGTGGAGG - Intronic
954143953 3:48624983-48625005 CATGTGACCCAGCAGGCAGTGGG - Intergenic
954453578 3:50585074-50585096 CATGGGTCCCAGAAGGGAGTGGG + Intergenic
955146076 3:56321143-56321165 CATGTAAGACAGGAGGCAGGTGG + Intronic
955324993 3:58003169-58003191 CATTTCACCTAGCAGGGAGGAGG + Intergenic
955880573 3:63540318-63540340 CATGTGACACAGCAAGGAAGTGG + Intronic
956055541 3:65294860-65294882 CATGTGAGACAGGTGGGAGATGG + Intergenic
956172858 3:66446289-66446311 CCTGTGACCAAGCGGGGAGGTGG - Intronic
956314049 3:67914578-67914600 CAAGTGACCCAGGAGAGTGTTGG + Intergenic
956471080 3:69567364-69567386 CAGGTTACCCAGGAGAGAGTGGG - Intergenic
957084820 3:75669447-75669469 CAGGCGACCCACGAGGGAGCAGG - Intergenic
958737744 3:98029270-98029292 TGTGTGACCCAGGAAGGAAGAGG - Intronic
959563856 3:107814567-107814589 CATTTGGCCCAGGAAGGAGGTGG + Intergenic
961314411 3:126024777-126024799 CACGTGACCCAGGAGAGAGCTGG + Intronic
961566059 3:127763979-127764001 CCTGAGAGCCGGGAGGGAGGAGG - Intronic
961872091 3:129996029-129996051 AATGAGACCCAGGAGACAGGAGG - Intergenic
961878997 3:130047041-130047063 CATGTGTCATAGGAGGGACGTGG + Intergenic
962327303 3:134446803-134446825 GAAGGGACCCAGGAAGGAGGAGG + Intergenic
962828757 3:139121486-139121508 AACGGGACCCAGGAGGGATGGGG + Intronic
967065032 3:185907582-185907604 CAAGTGACCGAAGAGAGAGGAGG + Intergenic
967210315 3:187162480-187162502 CATGTGAGGGAGGAGAGAGGAGG - Intronic
968120144 3:196120319-196120341 CTTGTGTCCTAGGAGGGATGGGG + Intergenic
968817157 4:2828077-2828099 CATGTGCTGCAGGAGGTAGGTGG - Intronic
968850125 4:3073396-3073418 CCTGTGTCCCAGGCGTGAGGGGG + Intergenic
968969604 4:3786732-3786754 TATGTGCTCCAGGTGGGAGGAGG - Intergenic
969049809 4:4364736-4364758 CATGTGTTCCAGGAGGGACCTGG - Intronic
969214615 4:5711697-5711719 CTTCTGCTCCAGGAGGGAGGTGG + Intronic
969345735 4:6568694-6568716 CATGTAAGGCAGGAGGAAGGGGG - Intergenic
969436304 4:7191551-7191573 CAAGGGACCCAGCTGGGAGGTGG + Intergenic
969495493 4:7523885-7523907 CAGGGGCCCAAGGAGGGAGGGGG - Intronic
971308172 4:25501855-25501877 GGTGTCACACAGGAGGGAGGTGG - Intergenic
971936112 4:33149873-33149895 CATGTGACCCAGGAGGGTGCAGG - Intergenic
972848395 4:43018147-43018169 CATGGGACCCAGTAGGGAACAGG + Intronic
978449275 4:108813057-108813079 CATGTGACCAAGTAGGAAAGAGG - Intronic
980922242 4:139098550-139098572 CATTTGAACCTGGAGGGTGGAGG - Intronic
981490672 4:145336269-145336291 CAGGTTACACAGGAGTGAGGAGG - Intergenic
982106372 4:152015223-152015245 CATGAGGCCCGGGAGGGAAGTGG + Intergenic
982298373 4:153853602-153853624 CATTTGAACCTGGAGGGTGGAGG - Intergenic
982712175 4:158768862-158768884 CACGTAACCCCGGCGGGAGGCGG - Intergenic
983789788 4:171782668-171782690 CATGTGTCACAGGAGGGACACGG - Intergenic
984833183 4:183995129-183995151 GATGTCACCCAGGAAGGAGCAGG + Intronic
985813537 5:2109569-2109591 CATGGTACCCAGGAGTGATGTGG - Intergenic
985955417 5:3262042-3262064 CATGTGTCAAGGGAGGGAGGTGG + Intergenic
986083272 5:4416131-4416153 AATTTGACTCAGGAGGTAGGAGG - Intergenic
986184172 5:5421293-5421315 CATGTGACCCATTAGGGAAAGGG - Intronic
986273131 5:6251569-6251591 CATGGCACCCTGGAGGGATGGGG - Intergenic
986720512 5:10557758-10557780 CTTATGAACCAGGAGGGATGGGG - Intergenic
986765731 5:10924318-10924340 CATGTGGAGCAGGAGTGAGGAGG - Intergenic
988486901 5:31674902-31674924 CCTCTGACCCAGGGGGGTGGAGG + Intronic
990208502 5:53455708-53455730 CATGTGACCCAAGAGTAAGGGGG - Intergenic
991305564 5:65172845-65172867 CCTGTGACCCAGCGAGGAGGAGG + Exonic
994010302 5:94894613-94894635 CATGTGTCTCTGGAAGGAGGAGG + Intronic
994764388 5:103898972-103898994 CATGTGTCCTAGGAGGGACCTGG + Intergenic
994926251 5:106120722-106120744 CCTGTGAACCTGGAGGCAGGAGG - Intergenic
996194440 5:120586087-120586109 CATGTGAACCAGGGAGGTGGAGG + Intronic
996376540 5:122814831-122814853 CATTTGAACCTGGAGGGTGGAGG - Intronic
997490029 5:134267401-134267423 CATGTGACCCATGATGGCTGCGG - Intergenic
998568998 5:143240250-143240272 CATTTGCTGCAGGAGGGAGGTGG + Intergenic
999088009 5:148910653-148910675 CCTGTGACACAGGAAGGAGCAGG + Intergenic
999255822 5:150209609-150209631 GATGTGAGGCAGGAGGCAGGCGG + Exonic
999914043 5:156238058-156238080 CTAGTTACTCAGGAGGGAGGTGG - Intronic
1001778220 5:174345079-174345101 AATGTGACACAGGCTGGAGGTGG - Intergenic
1002032585 5:176441447-176441469 CATGTGACCCAGAAGTGCAGGGG - Intergenic
1002170400 5:177371283-177371305 GCTGTGGCCCAGGAGGAAGGGGG + Intronic
1002487621 5:179550536-179550558 CATGTGACCCAGCGGGCGGGCGG - Exonic
1002507926 5:179693060-179693082 CATGTGAACTCGGAGGGTGGTGG + Intronic
1002635487 5:180605896-180605918 GATGTAACCCAGGAGTGAGGAGG + Intronic
1004347965 6:14866000-14866022 CATGTGACCAGGGAGGGAAATGG - Intergenic
1004402354 6:15300328-15300350 CATGTGTACAAGGAGGGAAGCGG + Intronic
1006187324 6:32188859-32188881 CCTGAGAACAAGGAGGGAGGAGG + Intronic
1006297174 6:33174879-33174901 CATCTACCCCATGAGGGAGGTGG + Intronic
1007380975 6:41489822-41489844 CAGGTGCTGCAGGAGGGAGGAGG + Intergenic
1007702205 6:43771867-43771889 CAGGTGGCCCAGCAGGGAGGGGG - Intronic
1009366529 6:62861400-62861422 CATAAGAGCCAGGAGGGAGAAGG + Intergenic
1012310802 6:97721825-97721847 TATGTGACCAAGAAGGGAGTAGG - Intergenic
1012889287 6:104880303-104880325 CATATGTAACAGGAGGGAGGGGG + Intergenic
1013174828 6:107668306-107668328 CATCTGAGCCAGGAGGGCAGAGG + Intergenic
1013274218 6:108568676-108568698 GATGTGACTCAGGAGTGAGCTGG + Intronic
1013549471 6:111192876-111192898 CATGTGTCCTAGGAGGGACCTGG - Intronic
1013784477 6:113764494-113764516 CATTTGAACCCGGAGGGTGGAGG - Intergenic
1014753421 6:125277832-125277854 CATGTGTTGCAGGTGGGAGGTGG + Intronic
1016775981 6:147905263-147905285 CACTTGAACCTGGAGGGAGGCGG - Intergenic
1017540831 6:155400843-155400865 CATGAGACCAATGAGGGAGCTGG - Intronic
1017843989 6:158240805-158240827 CATGCCATCCGGGAGGGAGGTGG - Intronic
1018677048 6:166231198-166231220 CATTTGAACCCGGAGGGTGGAGG + Intergenic
1019541020 7:1551040-1551062 CAGGTGAGCCGGGAAGGAGGTGG + Intronic
1019541048 7:1551122-1551144 CAGGTGAGCCGGGAAGGAGGTGG + Intronic
1019541088 7:1551242-1551264 CAGGTGAGCCGGGAAGGAGGTGG + Intronic
1019541115 7:1551324-1551346 CAGGTGAGCCGGGAAGGAGGTGG + Intronic
1019541143 7:1551406-1551428 CAGGTGAGCCGGGAAGGAGGTGG + Intronic
1020335639 7:7060248-7060270 CCTATCACCCAGGAGGGAAGAGG - Intergenic
1020719731 7:11726836-11726858 CATGAGACCCACTAGGGATGCGG - Intronic
1021972408 7:25978668-25978690 GATGTCAGCCAGCAGGGAGGTGG + Intergenic
1023372564 7:39526873-39526895 CAAGTGATCCAGGAGAAAGGAGG - Intergenic
1024426236 7:49229535-49229557 CCTGTGACCCAGGACCCAGGTGG + Intergenic
1024492123 7:49997480-49997502 AGTGTGACCAATGAGGGAGGTGG - Intronic
1024541060 7:50475495-50475517 GCTGTGAGCCAGGAGGCAGGGGG - Intronic
1024542270 7:50486600-50486622 CATGTGAATGAGGAGGAAGGGGG - Intronic
1024564807 7:50672557-50672579 CCTGTGACCCTGTAGGGAGAGGG + Intronic
1026236211 7:68529246-68529268 CATGTTGCCCAGGCTGGAGGGGG + Intergenic
1026466814 7:70661431-70661453 CAGGTGACCAGGGTGGGAGGAGG + Intronic
1026527297 7:71165596-71165618 CATGTGTCCCATGAGGGACCCGG - Intronic
1027176428 7:75906700-75906722 AATGAGAAACAGGAGGGAGGCGG - Intronic
1029589421 7:101497274-101497296 CATGTGACCCAGGGAGCGGGAGG + Intronic
1029625106 7:101715898-101715920 CATGTGCCCCAGGAGGAAGCGGG + Intergenic
1030898692 7:115094420-115094442 CATGTGATACAGGAAGAAGGTGG - Intergenic
1031380759 7:121083334-121083356 CAAGTGCCCCATGTGGGAGGGGG - Intronic
1032101001 7:128977678-128977700 CATTTGAACCCGGAGGGTGGAGG - Intronic
1032259348 7:130322434-130322456 CATCTAACCCAGGAGGGAACTGG + Intronic
1032326807 7:130936518-130936540 GTTGTGGTCCAGGAGGGAGGTGG - Intergenic
1032394874 7:131582040-131582062 CAGAGGAGCCAGGAGGGAGGGGG - Intergenic
1032467463 7:132155260-132155282 CAGGTTACACAGCAGGGAGGTGG - Intronic
1032794660 7:135268190-135268212 CAGTGGACCCAGGAGGAAGGAGG - Intergenic
1033584740 7:142765821-142765843 TATGTGGCCCAGGTAGGAGGTGG - Intergenic
1035034366 7:155885491-155885513 CAGGGCACCCAGGACGGAGGAGG - Intergenic
1035714070 8:1740398-1740420 CATCAGACTCTGGAGGGAGGAGG - Intergenic
1035909603 8:3550773-3550795 TCTGTGACCCAGGAAGGATGTGG - Intronic
1037650931 8:20837947-20837969 CATTTGACACAGGAGGGACCTGG - Intergenic
1037659096 8:20911964-20911986 CGTGTGACCCAGAAGGCAGGTGG - Intergenic
1039049422 8:33479326-33479348 CACTTGAACCAGGAGGGAGGTGG + Intronic
1039574630 8:38613274-38613296 AAGCTGATCCAGGAGGGAGGAGG + Intergenic
1039591379 8:38752720-38752742 CCTGTGACACAAGAAGGAGGAGG - Intronic
1039844595 8:41316805-41316827 CAGGGCTCCCAGGAGGGAGGCGG + Intergenic
1041149428 8:54915888-54915910 CATGAGATCCTGGAAGGAGGGGG + Intergenic
1041413410 8:57581541-57581563 CATGTGAACCAGGGAGGCGGAGG - Intergenic
1041992915 8:64015970-64015992 GTTGTGACCCAGAAGGTAGGAGG + Intergenic
1042159514 8:65877939-65877961 CAGGTTCCCCAGGAGAGAGGCGG + Intergenic
1042346793 8:67735902-67735924 AATGTGCCCCTGGAGGGAGAGGG - Intronic
1044318989 8:90780996-90781018 CCTGGGATCCAGGAAGGAGGTGG - Intronic
1044626603 8:94240319-94240341 CATATGGCCCAAGAGGTAGGGGG + Intergenic
1046917514 8:119692834-119692856 CATGTGTCACAGGAGGGACTTGG + Intergenic
1047094987 8:121615418-121615440 CATTTGAACCAGGAAGGCGGAGG - Intronic
1047248559 8:123165046-123165068 AAGGAGACCCAGGAGGAAGGCGG + Intergenic
1047711925 8:127561144-127561166 CATCTGACCCAGAAGGGAACTGG + Intergenic
1048192552 8:132302954-132302976 CATGCTCCCCAGGAGGGTGGTGG - Intronic
1048866650 8:138766322-138766344 CATGTGACAGAGGAGCGAGGTGG + Intronic
1049243239 8:141549223-141549245 CATGTGGCCCCCGAGGGAGCAGG + Intergenic
1049311490 8:141936073-141936095 CAGGAGACCCAGGAGGGACCAGG - Intergenic
1049408569 8:142462473-142462495 CATGGGAGCCAGGAGGCCGGAGG - Intronic
1049412229 8:142478462-142478484 CATGTGACTGAGGAGGGAGTGGG + Intronic
1051563034 9:18464276-18464298 CATATGACACAGAAGGGAGAGGG - Intergenic
1051961002 9:22762710-22762732 CACTTGACCCTGGAAGGAGGAGG - Intergenic
1053434343 9:38065611-38065633 CTTTCTACCCAGGAGGGAGGAGG - Intronic
1053473390 9:38363473-38363495 TCTGTGAGCCAGGAGGGAGGAGG + Intergenic
1055445666 9:76379816-76379838 AATGTGAACCATGAGGGAGGAGG + Intergenic
1057079289 9:92160257-92160279 GCTGGGACCCAGGATGGAGGTGG + Intergenic
1057208817 9:93188609-93188631 CATGTGGGCAAGGAGGAAGGCGG - Intronic
1058629388 9:106970875-106970897 AATCTGATCTAGGAGGGAGGAGG - Intronic
1060039536 9:120287841-120287863 CATATGAACCAGGAAGGTGGAGG + Intergenic
1060219051 9:121754845-121754867 CATGCGCCCCAGGCAGGAGGCGG + Intronic
1060688610 9:125635879-125635901 CATGGGACCCAGAAAGTAGGGGG + Intronic
1060875023 9:127077062-127077084 CATGGGAGTCAGGAGGGAGTGGG + Intronic
1061056243 9:128224468-128224490 CATGCTACCGAGGAGGCAGGGGG - Intronic
1061093975 9:128443699-128443721 CAGCTGGCCCAGGAAGGAGGAGG + Intergenic
1061253452 9:129439796-129439818 CACCTGACTCAGCAGGGAGGAGG + Intergenic
1061575040 9:131501120-131501142 CCTGGGCCCCAGGAGGGAGTGGG - Intergenic
1185509483 X:652443-652465 CATGTGAGCTGGGAGGGAAGTGG + Intronic
1185521581 X:743973-743995 CCTGAGACCCAGGAGAGACGAGG - Intergenic
1185521587 X:744023-744045 CCTGAGACCCAGGAGAGCGGAGG - Intergenic
1185683702 X:1909789-1909811 GCTGAGGCCCAGGAGGGAGGGGG - Intergenic
1187737219 X:22317125-22317147 CTTCTGACCCAGGGGGAAGGGGG + Intergenic
1188477145 X:30602430-30602452 CATGCCATCCGGGAGGGAGGTGG + Intergenic
1190277212 X:48906536-48906558 CACGTTACCTAGGTGGGAGGAGG + Exonic
1190798688 X:53769208-53769230 CATGTGACCCATGATGGCAGCGG + Intergenic
1191068918 X:56380157-56380179 CACCCCACCCAGGAGGGAGGTGG - Intergenic
1191764488 X:64682365-64682387 CAGGGGACACAGGAGGAAGGGGG + Intergenic
1192001221 X:67153894-67153916 CATGTGAGATAGGAGAGAGGTGG - Intergenic
1192588235 X:72337820-72337842 CAAGTGAGCAAGGAGGGTGGTGG - Intronic
1193876985 X:86872927-86872949 AATGTGACCCATGAGGAAGTGGG + Intergenic
1196554875 X:117074576-117074598 CATGTGTCACAGGAGGGAAGAGG - Intergenic
1196856549 X:119990584-119990606 CGTGTGGCCCTGGAGGCAGGCGG - Intergenic
1200182963 X:154162366-154162388 CAGGAGGCCCAGGAGGGTGGCGG + Intergenic
1200188617 X:154199480-154199502 CAGGAGGCCCAGGAGGGTGGCGG + Intergenic
1200194266 X:154236621-154236643 CAGGAGGCCCAGGAGGGTGGCGG + Intergenic
1200200022 X:154274424-154274446 CAGGAGGCCCAGGAGGGTGGCGG + Intronic
1200210528 X:154344973-154344995 CAGGTGGCCCAGGAGTGTGGGGG - Intergenic
1200220324 X:154387119-154387141 CAGGTGGCCCAGGAGTGTGGGGG + Intergenic
1200358551 X:155578052-155578074 CATCAGGCCCAGGAGGGAGATGG + Intronic