ID: 1063981498

View in Genome Browser
Species Human (GRCh38)
Location 10:11455694-11455716
Sequence AGGCCTGCTGGGGTTTCCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 364
Summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 330}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063981498_1063981505 28 Left 1063981498 10:11455694-11455716 CCTATGGAAACCCCAGCAGGCCT 0: 1
1: 0
2: 4
3: 29
4: 330
Right 1063981505 10:11455745-11455767 TAAGTTATACAGAAATGCAGAGG 0: 1
1: 0
2: 2
3: 44
4: 370

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063981498 Original CRISPR AGGCCTGCTGGGGTTTCCAT AGG (reversed) Intronic
900626184 1:3609763-3609785 AGACTTGCTGGGGTCTCCAGGGG - Intronic
901126614 1:6934010-6934032 AAGCCTGCTGGGATTTTGATTGG + Intronic
902378478 1:16041589-16041611 AGGAGTGCTGGGGGTTCCTTAGG - Intergenic
904765425 1:32842525-32842547 AGGCTTGGTGGGATTTCCATTGG + Intronic
904881563 1:33701282-33701304 GGGCCTGCTGGGCTTGCCAAGGG + Intronic
906238528 1:44227177-44227199 AGGTCTGCTGGAGTCTCCACAGG + Intronic
906527408 1:46502976-46502998 AATCCAGCTGGGATTTCCATTGG + Intergenic
909573448 1:77145335-77145357 AAGCCTGCTGGGGTTTTGATTGG + Intronic
913226097 1:116699999-116700021 ATGCCTGCTGGGATTTTGATTGG + Intronic
913342742 1:117775704-117775726 AGGCCTGCTGGGATTTTGATTGG - Intergenic
913696965 1:121336059-121336081 GGCCTTTCTGGGGTTTCCATGGG + Intronic
914140594 1:144943985-144944007 GGCCTTTCTGGGGTTTCCATGGG - Intronic
914404712 1:147358836-147358858 AGGGCTGCTGCGGTTTGCTTGGG - Intergenic
915104710 1:153526530-153526552 AGGCTTGCTGGGGATTTTATAGG - Intergenic
915902683 1:159857667-159857689 GGACCTGTTGGGGTTTCCTTGGG - Intronic
918874064 1:190015548-190015570 AAGCCTGCTGAGATTTCAATTGG - Intergenic
918955329 1:191199593-191199615 AGGTCTGCTGTGGTTTCCTGGGG - Intergenic
919034338 1:192286778-192286800 AAGCCAGCTGGGATTTCGATAGG - Intergenic
919174442 1:194001883-194001905 AGGCCTGCTGGAGTTCCCGGTGG + Intergenic
919891181 1:201976212-201976234 AATCCTGCTGGGGTTTTTATTGG + Intergenic
920108870 1:203573254-203573276 GGCCCTGCTGGGTTTTCCTTAGG - Intergenic
920502876 1:206496530-206496552 AGGCCTCCTGGGGTTTCCCCAGG + Exonic
920797929 1:209158549-209158571 AGGACTGCTGGGCTTTCAAAAGG - Intergenic
921108534 1:212009433-212009455 ACTCCTGCTGGGCTCTCCATTGG - Intronic
921176023 1:212595354-212595376 GGGGCTGCTGAGGTTGCCATGGG - Intronic
922754555 1:228088339-228088361 AAGCCTGCTGGGGTGTGCAGTGG + Intronic
923660907 1:235956473-235956495 AAGCCTGCTGGGATTTTGATAGG - Intergenic
924744961 1:246823184-246823206 ATGCCTGCTGGGGTTTTGATTGG + Intergenic
1062976731 10:1689148-1689170 AGGCTTGCTGGGGATTTTATAGG + Intronic
1063041149 10:2338485-2338507 AAGAATGTTGGGGTTTCCATGGG - Intergenic
1063067507 10:2624126-2624148 AGCCCTGCTGGGCTGCCCATCGG + Intergenic
1063981498 10:11455694-11455716 AGGCCTGCTGGGGTTTCCATAGG - Intronic
1065615647 10:27519777-27519799 AAGCCTGCTGGGATTTTGATAGG - Intronic
1065804857 10:29384839-29384861 AGGCTTGCTGGGGATTTTATAGG + Intergenic
1065944282 10:30592943-30592965 AGGCTTGCTGGGGATTTTATAGG - Intergenic
1067290003 10:44933580-44933602 AGTCTTGCTGGGGTTTTCCTGGG + Intronic
1068118672 10:52762149-52762171 AGTCCTGCTGTGGGTTACATGGG + Intergenic
1071133524 10:82425178-82425200 AGGCCAGCTGGGGTTACAGTAGG + Intronic
1072016378 10:91350631-91350653 ATGCCTGCTGGGATTTCAAAGGG + Intergenic
1072785581 10:98277835-98277857 AAACCTGCTGGGATTTTCATTGG + Intergenic
1074199013 10:111215760-111215782 AGGCCTGCTGGGATTTTGATGGG + Intergenic
1074699536 10:116080997-116081019 AGGTCTGGGGGGGTTTCCAATGG - Intronic
1075731657 10:124640057-124640079 AGGCTTGCTGGGGGTTCCTAGGG - Intronic
1076087345 10:127645987-127646009 AGGTCTGCTGGAATTTCGATAGG - Intergenic
1076480737 10:130783717-130783739 GGGTCTGCTGGGGTGTCCACCGG + Intergenic
1076586400 10:131551105-131551127 AGGCCAGCTGAAGTTTCCAAGGG - Intergenic
1077041182 11:524087-524109 AGTCCTGCTGGGATTTTGATTGG - Intergenic
1077168382 11:1153814-1153836 CGGCCTGGTGGGGTTTTCATGGG + Intergenic
1077258511 11:1601956-1601978 AGGCTTGCTGGGGATTTTATAGG - Intergenic
1077475171 11:2784566-2784588 GGGCCTGCTGGGATTTTGATAGG + Intronic
1078008295 11:7548949-7548971 AGGCCTGCAGTGCTTTCCTTGGG - Intronic
1078676969 11:13429248-13429270 AAGCCTACTTGGTTTTCCATTGG - Intronic
1078834607 11:15015037-15015059 AGGGCTGCTGTGGTTTCCTGGGG - Intronic
1078989024 11:16626580-16626602 AAGCCTGCTGGGATTTTTATTGG + Intronic
1079276362 11:19040851-19040873 AGGGCTGCTGTGGTTTGCTTGGG - Intergenic
1080387509 11:31818555-31818577 AGGCCTGCTGGGTTCTCAAGAGG + Intronic
1081602248 11:44503573-44503595 AGGCTTGCTGGGCTTTCCCTGGG - Intergenic
1081798757 11:45842150-45842172 AGGCTTGCTGGGGATTTTATAGG + Intergenic
1082884177 11:58066457-58066479 ACACCTGCTGGGGCTTCCATGGG + Intronic
1083193907 11:61071687-61071709 AGACCTGCAGGGGAATCCATGGG - Intergenic
1083652233 11:64210438-64210460 AGCCCTGCTGCTGTTACCATGGG + Intronic
1083993761 11:66262060-66262082 AGGGCAGCCGGGGTGTCCATGGG - Intronic
1084362977 11:68681088-68681110 AGGCGTGCTGGGGTTTCCTGAGG - Intergenic
1084803014 11:71558031-71558053 AGGCTTGCTGGGGATTTTATAGG + Intronic
1089272214 11:117309348-117309370 AGGCATGGTGGGGATGCCATGGG - Intronic
1089340047 11:117751023-117751045 TGGCTTTCTGAGGTTTCCATTGG + Intronic
1089514473 11:119023465-119023487 AAGGCTGCTGGGATTTCCACTGG - Exonic
1089711377 11:120317244-120317266 AGGCCTGCTGTTGTTCCCAGGGG - Exonic
1091455460 12:604167-604189 AAGTCTGCTGGGGTTTTGATGGG + Intronic
1091783895 12:3230848-3230870 AGTCCTGCAGGGGTCTCCAGGGG - Intronic
1092492569 12:8958870-8958892 AATCCTGCTGGGGTTACAATTGG + Intronic
1092794649 12:12098182-12098204 AAGCCTCCTGGGACTTCCATTGG + Intronic
1093373682 12:18396879-18396901 AAACCTGCTGGGATTTTCATTGG - Intronic
1093665548 12:21808577-21808599 AGACTTGCTGGGCTTTCCACAGG + Intronic
1094004621 12:25736494-25736516 AGGCCTGCCCTGGTATCCATGGG - Intergenic
1095138311 12:38633715-38633737 AGGTATACTGGGGTTTTCATGGG + Intergenic
1095589196 12:43884904-43884926 AGGCTTGCTGGGGATTTTATAGG - Intronic
1098830053 12:75350583-75350605 AGGGCTGCTGTGGTTTCCTGGGG - Intronic
1100708989 12:97233579-97233601 AAGCCTGCTGGGATTTTAATTGG + Intergenic
1100905723 12:99296353-99296375 AAGCCTGCTGGGATTTTGATTGG + Intronic
1101206500 12:102493649-102493671 AGGTCTGCTGGAGTTTGCAGGGG + Intergenic
1101428691 12:104608484-104608506 AGGCTTGCTGGGGATTTTATAGG - Intronic
1102195543 12:111022700-111022722 AGGCCTGCTGGGGCTTCTTGTGG + Intergenic
1102346014 12:112161902-112161924 AGGCCTGCTGGGGCTGCCTCTGG + Exonic
1102554507 12:113718144-113718166 AGACTTGCTGGAGATTCCATGGG - Intergenic
1103053787 12:117802731-117802753 AGGCCTACTGGGGTATCTGTGGG - Intronic
1103423070 12:120805981-120806003 AAGCCTGCAGGGATTTCGATAGG - Intronic
1105035156 12:132914243-132914265 ACTCCTGCTGGAATTTCCATTGG + Intronic
1105250922 13:18697993-18698015 AGGCCTGCAGGGGCTGCCGTGGG + Intergenic
1105413201 13:20188756-20188778 AGGCCTACAGGGGTTTCAAATGG + Exonic
1105576576 13:21658750-21658772 AGAACTGTTGGGGTTTGCATGGG + Intergenic
1105899236 13:24741883-24741905 AGGCCTGCTGGGGTGGCCCCAGG - Intergenic
1106833668 13:33611736-33611758 AAGCCTGCTGGGCTTTACAAAGG - Intergenic
1107211802 13:37866940-37866962 AATCATGGTGGGGTTTCCATAGG + Intronic
1107240836 13:38231762-38231784 AGGGCTGCTGTGGTTTTCCTGGG - Intergenic
1107389967 13:39953577-39953599 GGGCCTTCTTGGGTTTGCATTGG - Intergenic
1109141875 13:58723323-58723345 AGCCCTGCTGGGTTTTTTATTGG - Intergenic
1109146792 13:58790050-58790072 AGGGCTGCTGTGGTTTCCTGGGG + Intergenic
1109278015 13:60323457-60323479 AGCCCTTCTGGGGTTTCTAGTGG + Intergenic
1111641722 13:90977939-90977961 AGGGCTGCTGCGGTTTCCTGAGG - Intergenic
1112285409 13:98099762-98099784 AGGCTTGCTGGGGATTTTATAGG - Intergenic
1113054608 13:106254519-106254541 CCGCCTGCTGAGGTTTCCAAAGG - Intergenic
1113338686 13:109401413-109401435 AGGCCGGTTGGGGTTTCCCCAGG - Intergenic
1113349975 13:109519619-109519641 AGCCAAGCTGTGGTTTCCATGGG + Intergenic
1113972953 13:114204186-114204208 AGGCTTGCTGGGGATTTTATAGG + Intergenic
1114356278 14:21912700-21912722 AGGCCTGCTGGAGATTTTATAGG - Intergenic
1115493585 14:33981796-33981818 AGGGCTGCTGAGGATTCCACAGG + Intronic
1115561728 14:34588771-34588793 GGGCCTGCTGGGATTTTGATTGG - Intronic
1117496929 14:56314693-56314715 AGTCTTACTGTGGTTTCCATGGG - Intergenic
1119602622 14:75986704-75986726 AGGCCTGATGGGGGTTACAAAGG - Intronic
1121409096 14:93737186-93737208 AGCCCAGCTGGGGTTCCCTTCGG + Intronic
1122776324 14:104118430-104118452 AGGCCTGCTAGGGTGGCCTTGGG + Intergenic
1122783351 14:104153050-104153072 AGGCCTGGTGGTGTTTCCAGGGG + Intronic
1123001525 14:105297635-105297657 AGTCCTGGTGGGGTTTTCATTGG - Intronic
1123706543 15:22955125-22955147 GGGCATGCTGGGGGCTCCATGGG + Intronic
1125373283 15:39000667-39000689 AGGGCTGCTGTGGTTTGCTTGGG - Intergenic
1126248869 15:46542710-46542732 AAACCTGCTGGGATTTTCATTGG + Intergenic
1126559149 15:50024622-50024644 AGACTTGCTGGGGTTTGCAGTGG - Intronic
1127410965 15:58706683-58706705 ATGCCTGGTGGGGTGTACATTGG - Intronic
1127832115 15:62760098-62760120 CGGCGTGCAAGGGTTTCCATTGG + Intronic
1128327340 15:66733330-66733352 AGGCCTGCTAGGGTTTTGATTGG + Intronic
1128555515 15:68629077-68629099 AGGTCTGCTGGGGGAGCCATGGG + Intronic
1128768510 15:70265475-70265497 AGGGCTGCTGTGGTCCCCATGGG - Intergenic
1129058640 15:72841720-72841742 AAGCCTGCTGGAATTTTCATTGG + Intergenic
1130043269 15:80424059-80424081 ACCCCTGCTGGAGTTTTCATTGG - Intronic
1130690437 15:86077528-86077550 AGGGTTGCTGGGGTCTCCACAGG + Intergenic
1131185065 15:90266842-90266864 AGGGATGCTGGTGCTTCCATAGG + Intronic
1131402275 15:92134851-92134873 AGGCCTGCTGGGGTAGAAATTGG + Intronic
1132666789 16:1084620-1084642 GGGCCTGCTGGGCTCTCCAGTGG + Intergenic
1133099371 16:3469990-3470012 GGGCCTGCTGGGGCTGCCCTGGG + Intronic
1133268716 16:4600212-4600234 GGGCCTGCTGGGGGTCCCTTAGG - Exonic
1136995378 16:35185424-35185446 GGGCCTGCTGTGGTCTCCACTGG + Intergenic
1137056373 16:35748341-35748363 AGGCCTCCTGGGGTTTAGATGGG + Intergenic
1138690403 16:58762525-58762547 AAGCCTGCTGGGGTTTTGATTGG + Intergenic
1138705457 16:58910713-58910735 AGGCTTGCTGGGGATTTTATAGG + Intergenic
1140669980 16:77268884-77268906 AGGCCTGCTGGCCTTTGGATGGG + Intronic
1142052180 16:87965868-87965890 TGGACTGCTGAGCTTTCCATAGG - Intronic
1142394608 16:89824926-89824948 AGTCCTGCTGGTGAGTCCATAGG + Intronic
1144703529 17:17353307-17353329 AGGCCTGCTGGGGCTGCCCTAGG + Intergenic
1145909587 17:28534805-28534827 AGGCCAGCTGGGGGTGCCAGGGG - Exonic
1146657797 17:34645290-34645312 AGCCCTCCTGTGGTTCCCATGGG + Intergenic
1148569760 17:48658886-48658908 AGGTCTGTTGGGGGTCCCATGGG + Intergenic
1148848203 17:50541307-50541329 AGGGCTGCTGGGCTTCCCAGAGG - Exonic
1149242071 17:54662764-54662786 AGGACTGCTGTGGTTTCCTGGGG + Intergenic
1150941125 17:69695777-69695799 AGGCTTGCTGGGGATTTTATAGG + Intergenic
1151354138 17:73548595-73548617 AAGCTTGCTGGGGTTCCCAGTGG + Intronic
1151953694 17:77369962-77369984 AGGCGTGCAGGGGTTTCCTATGG + Intronic
1151997546 17:77619484-77619506 AGGCCGGCTGGAGTTTCTCTTGG - Intergenic
1152254831 17:79232229-79232251 ATGCCTGCTGGGATTTTGATCGG - Intronic
1152298362 17:79481421-79481443 AAAACTGCTGGGGTTTCCAAGGG + Intronic
1153341780 18:3982565-3982587 AGACGTGGTGAGGTTTCCATGGG + Intronic
1154437923 18:14360921-14360943 AGGCCTGCAGGGGCTGCCGTGGG - Intergenic
1155458394 18:26047065-26047087 AGGCCTGCCTGTATTTCCATAGG + Intronic
1156246142 18:35300520-35300542 AGACCTGCTGGGATTTTGATTGG + Intergenic
1156453910 18:37282174-37282196 CTGCCAGCTGGGGTTCCCATGGG - Intronic
1158204316 18:54974865-54974887 AGGCCTGCTTCTGTTTCCAGAGG - Intergenic
1158895330 18:61907563-61907585 ATGGCTGCTGGGATTGCCATGGG + Intergenic
1159378991 18:67632026-67632048 AGGTCAGCTGTGGTTACCATTGG + Intergenic
1160715545 19:574906-574928 AGGCCTGGCTGGGTTTCCACAGG - Intronic
1161936578 19:7376053-7376075 AGGCCTGAAGGGATTTCCCTGGG + Intronic
1163069923 19:14830981-14831003 AGGCTTGCTGGGGATTTTATAGG - Intronic
1164711898 19:30362728-30362750 AGGACTGTTGGGCTTACCATTGG + Intronic
1165049509 19:33132522-33132544 AAGCCAGGTGGGTTTTCCATGGG - Intronic
1165250045 19:34523823-34523845 AGGCTTGCTGGGGATTTTATAGG + Intergenic
1166275463 19:41750479-41750501 AGGCCTCCTTGTGTGTCCATCGG - Intronic
1166396255 19:42443504-42443526 AGGCCTCCTTGTGTGTCCATCGG + Intergenic
1166898957 19:46043400-46043422 AATCCTGCTTGGGTTTTCATTGG - Intronic
1166907430 19:46121811-46121833 AGGCTTGCTGGGGATTTTATAGG + Intronic
1167150484 19:47706378-47706400 AGGCTTGCTGGGGGTTGTATAGG + Intergenic
1167527134 19:49991392-49991414 AGGCCTGCTGGCCTTTGGATTGG + Intronic
925637204 2:5951760-5951782 AGGCTTGCTGGTGTTTCTACTGG - Intergenic
925919916 2:8631552-8631574 AGGCCTGCTGGGGTCTGCTTGGG - Intergenic
927150515 2:20192795-20192817 AAGCCTGCTGGGGTTCCCCTGGG - Intergenic
927612191 2:24552182-24552204 AAGCCTGCTGGGATTTTAATTGG + Intronic
929713741 2:44290465-44290487 AAGCCTGCTGTGGTTTTGATAGG + Intronic
930661011 2:54053260-54053282 AGGCATGCTGGGGGCCCCATAGG + Intronic
931236354 2:60416172-60416194 AAGCCTGCTGGGATTTTGATTGG + Intergenic
931275390 2:60739674-60739696 AGGCTTGCTGGGGATTTTATAGG + Intergenic
931538760 2:63305428-63305450 AGGTCTGCTGGAGTTTGCCTGGG - Intronic
932463033 2:71895695-71895717 AGGCCTGCTGAGGGGTCTATGGG - Intergenic
933534692 2:83557547-83557569 AGGTCTGCTGTGGTTTCCTGGGG + Intergenic
933776138 2:85772347-85772369 GGGCCTGCTGGTGAGTCCATGGG + Intronic
933842815 2:86301227-86301249 AAGCCTGCTGTGGTTTCCGCTGG - Intronic
933919273 2:87028222-87028244 AGGCTTGCTGGGGGTTTTATAGG - Intergenic
934003721 2:87741685-87741707 AGGCTTGCTGGGGGTTTTATAGG + Intergenic
935489319 2:103697851-103697873 AGGTCTGCTGCAGTTTGCATGGG + Intergenic
940114370 2:150192220-150192242 AGGCCTGGTGGGATTTCCTCTGG - Intergenic
941247641 2:163120258-163120280 AGGCTTGCTGGGGATTTTATAGG - Intergenic
942540525 2:177010412-177010434 AGGCTTGCTGGGGATTTCATAGG - Intergenic
943003891 2:182365010-182365032 AGGACTGCTAGTTTTTCCATTGG + Intronic
943068262 2:183111655-183111677 AGTCTTGCTGAGGTTTTCATAGG - Intergenic
943301073 2:186201041-186201063 AGGACTGCTGGGATTTCGTTTGG - Intergenic
943599701 2:189900853-189900875 AGGCTTGCTGGGGATTTTATGGG + Intronic
944468841 2:200031506-200031528 GGGCCTGCTGAGGTTTCCCCAGG - Intergenic
944544517 2:200785806-200785828 AGGCCTGCTGTGGCTTCTAAGGG - Intergenic
944914954 2:204349843-204349865 AACCCTGCTGGGGTTTTTATAGG + Intergenic
945493341 2:210481121-210481143 AGGTGTGCTGGGGTTTCCTTGGG + Intronic
946157210 2:217814845-217814867 AGGCCTGCTGTGTCTTCCCTGGG - Intronic
946477570 2:220023398-220023420 AGGCCTCCTGGGGTTGCCCTGGG + Intergenic
947736831 2:232459500-232459522 AGGCCTGCTTGGTCTTCCTTAGG - Exonic
948044450 2:234932812-234932834 AGGCCTGCGGGGGTTTTCATCGG - Intergenic
948089015 2:235276025-235276047 AGTCCTGCTGGGATTTGTATTGG - Intergenic
948728421 2:239948531-239948553 AGGCCTGCTGCTTTTTACATTGG - Intronic
948983174 2:241505360-241505382 AGTCCTCCTGGGGATTCCAGAGG + Intronic
949046483 2:241874722-241874744 GGGGCCGCTGGGGTCTCCATCGG - Intergenic
949059000 2:241945665-241945687 AGGCCTGATGGGATTTGCACAGG + Intergenic
1170037143 20:12001704-12001726 TTGCCTGCTGCGGTTTTCATAGG + Intergenic
1170127869 20:12985846-12985868 AGGCCTGGTGGGGATTCCATGGG + Intergenic
1171299722 20:24049940-24049962 AGGACACCTGGGGTGTCCATGGG + Intergenic
1172080368 20:32335952-32335974 AGGCCTGCTGGAGTGACCCTGGG + Intergenic
1172792620 20:37516382-37516404 AGGCTTGCTGGGGATTTCAGGGG - Intronic
1173791212 20:45828862-45828884 AGCCCTGCTGAGCTTTCCTTGGG - Intronic
1174098054 20:48105216-48105238 AGGCTACCTGGGGCTTCCATGGG - Intergenic
1174196587 20:48776573-48776595 GGGCCTGCTGGGTTTTCCGAGGG - Intronic
1175133800 20:56808359-56808381 CGGCCTGCTGAGCTTTCCACGGG + Intergenic
1176365189 21:6028521-6028543 AGGCTTGCTGGGGATTTTATAGG - Intergenic
1176835920 21:13793632-13793654 AGGCCTGCAGGGGCTGCCGTGGG + Intergenic
1176898816 21:14416247-14416269 AAGACTGCAGGGGTATCCATTGG - Intergenic
1177108837 21:16998760-16998782 AGGCCTGTTGGGATTTTCACTGG - Intergenic
1179758329 21:43510024-43510046 AGGCTTGCTGGGGATTTTATAGG + Intergenic
1179996624 21:44977293-44977315 AGGCCTGCAGGGGCTGCCGTGGG + Intergenic
1180843988 22:18971661-18971683 ATGCCTGCTGTGGTCTCCACGGG + Intergenic
1180973524 22:19830646-19830668 AAGCTTGCTGGTGTTTCCGTTGG - Intronic
1181057482 22:20267047-20267069 ATGCCTGCTGTGGTCTCCACGGG - Intronic
1181508832 22:23379761-23379783 AGGCCTGCTGGGATTGCAGTGGG + Intergenic
1182054737 22:27342063-27342085 AAGCCTGCTGGGATTTTGATTGG + Intergenic
1183617680 22:38955191-38955213 GGTCTTGCTGGAGTTTCCATAGG - Intronic
1184448205 22:44566263-44566285 AAGCCTGCTGGGATTTTAATTGG - Intergenic
1184484688 22:44769491-44769513 AAGCCTGCTGGGATTTTGATTGG + Intronic
1185004974 22:48270437-48270459 AGTCCTCCCGGGGTCTCCATGGG - Intergenic
949236139 3:1811154-1811176 ATGCCTGTAGGGGTTGCCATAGG + Intergenic
949805314 3:7949289-7949311 AGGCCGGCTGGAGTTTCTCTGGG - Intergenic
951324367 3:21285003-21285025 AGGTCTGCTGGAGTTTCTAGAGG + Intergenic
951910247 3:27742876-27742898 ATGCCTGCTGGGATTTTGATTGG + Intergenic
953013713 3:39052441-39052463 AGGCCTCCAGGGGTTTCCCAGGG + Intronic
953605611 3:44411377-44411399 AGGCCTGCCGGGATTCCCATGGG - Intergenic
953877849 3:46676614-46676636 AGCCCTGCTGGGGTGGCCAAGGG - Intronic
954105319 3:48406713-48406735 AGGGCTGCTGAGGTTCCCAAGGG + Intronic
954407799 3:50355222-50355244 AGGCCTGCTGGGGCTTTCCATGG - Exonic
955447907 3:59033072-59033094 AGGTCTGCTGGAGTTTGCAGTGG - Intronic
955824903 3:62935361-62935383 AGGTCTGCTGGTGCTTCCACTGG - Intergenic
957106106 3:75889835-75889857 AAGACTGCTGAGATTTCCATGGG - Intergenic
958073148 3:88640647-88640669 AGGGCTGCTGGAGTTTGCAGGGG + Intergenic
958483730 3:94676919-94676941 AGGGCTGCTGAGGTTTGCTTGGG - Intergenic
962427973 3:135290247-135290269 AGGCCTGCTGGTATTTTCAATGG + Intergenic
963039319 3:141057014-141057036 CCTCCTCCTGGGGTTTCCATGGG - Intronic
964904934 3:161707949-161707971 AGGTCTGCTGGGGTTTGCTGGGG - Intergenic
966950332 3:184811499-184811521 AGGCCTGCTGGGGGCTATATAGG - Intergenic
967718434 3:192789454-192789476 AGGCCTGGTGCGGTATCCACTGG + Intergenic
968092083 3:195904942-195904964 AAGCCTGCTGGGATTTTGATTGG - Intronic
968715002 4:2150433-2150455 AAGCCTGCTGAGATTTTCATTGG - Intronic
968735549 4:2294054-2294076 AAGCCTGCTGGGATTTTGATTGG - Intronic
969101351 4:4771023-4771045 TGGGCTGTTGGTGTTTCCATGGG + Intergenic
972684695 4:41340645-41340667 AGCAATGCTGGGGTTTCCATGGG + Intergenic
976059927 4:81115501-81115523 AGTTCTGCTGGAATTTCCATTGG + Intronic
976314310 4:83643179-83643201 AGGACTGCTGGGATTTCAACAGG - Intergenic
980864941 4:138543080-138543102 AGGGCTGCTGTGGTTTGCTTGGG - Intergenic
981202842 4:142002303-142002325 ATGCCTGCTGGGGTTTTGCTTGG + Intergenic
981273933 4:142875480-142875502 AGGGCTGCTGTGGTTTGCTTGGG - Intergenic
982769505 4:159383289-159383311 ATGCCTGCTGGGGTTTTCCAGGG - Intergenic
984055980 4:174929635-174929657 AGGCCAGCTGGAGTTTTTATGGG + Intronic
984655924 4:182318638-182318660 AGCCCAGCTGTGGTTTCCAGAGG + Intronic
985038597 4:185866034-185866056 AGGCCTTCTGGAATTTCCTTTGG - Intronic
986307361 5:6525595-6525617 AGGGCTTCTGGAGTTCCCATCGG - Intergenic
986484442 5:8220885-8220907 AGGTCTGCTGGAGTTTGCCTGGG - Intergenic
988980072 5:36559266-36559288 AGTCCAGCTTGGGTTTCAATAGG + Intergenic
989373873 5:40739290-40739312 AAGCTTGCTGGGATTTCGATTGG + Intronic
990938373 5:61174606-61174628 AGACATCCTGGGGTTCCCATTGG - Intergenic
997156732 5:131569179-131569201 AAGCCTGTTGGGGTTTTGATAGG - Intronic
997475758 5:134141532-134141554 AGGCCTGGTGAGGTCTCCTTGGG - Intronic
998205420 5:140153960-140153982 AGGGCTGCTTGGGTTTTCATGGG + Intergenic
1000263901 5:159616535-159616557 GGGCCTGCTGGAGCTTCCATTGG + Intergenic
1000676973 5:164132885-164132907 AAGCCTGCTGGGTTTTACACTGG + Intergenic
1001877596 5:175214878-175214900 TGGCCTGTTGGTGATTCCATAGG - Intergenic
1002003857 5:176216006-176216028 AGGCCTGCTGGGGATTTTATAGG - Intergenic
1002222514 5:177694600-177694622 AGGCCTGCTGGGGATTTTATAGG + Intergenic
1003043788 6:2714197-2714219 GGGCCAGCTGGGGATTCCTTTGG - Intronic
1003311276 6:4971860-4971882 AGGCCTGCTGGACTTGGCATTGG + Intergenic
1006525221 6:34598819-34598841 AGCCTTGCTGGTGTTTACATTGG - Intronic
1006988635 6:38194166-38194188 AGGCCCTGTGGGGTTTCCACAGG + Intronic
1007641169 6:43340967-43340989 AGGGGTGGTGGGATTTCCATTGG - Intronic
1008041311 6:46802117-46802139 AAGCCTGCTGGGATTTTGATAGG + Intronic
1009279041 6:61723110-61723132 AGTCCTGCTGTGGTTTGCTTGGG - Intronic
1009602016 6:65813297-65813319 CTGCCTGCTGGGTGTTCCATAGG - Intergenic
1010125380 6:72425849-72425871 AGCCCTGCTGGCCTTCCCATCGG - Intergenic
1010178052 6:73052506-73052528 TAGCCTGATGGGGTTTCCTTGGG - Intronic
1010369641 6:75092598-75092620 TGGACTGCAGTGGTTTCCATGGG - Intronic
1011080310 6:83483352-83483374 AAGCCTGCTGGGATTTTGATTGG - Intergenic
1011507839 6:88067763-88067785 AGGGCTGCTGTGGTTTGCTTGGG + Intergenic
1011556841 6:88578743-88578765 AATCCTGCTGGGATTTTCATAGG + Intergenic
1011972655 6:93246924-93246946 AGGCCAGCTGGGCAGTCCATGGG + Exonic
1011998624 6:93624632-93624654 CCTCCTGCTAGGGTTTCCATTGG + Intergenic
1012134819 6:95542763-95542785 AAGCCTCCTGGGCTTTCCCTAGG - Intergenic
1012597019 6:101053416-101053438 AGGTCTGCTGGGGTTTGCTGGGG + Intergenic
1013263382 6:108469615-108469637 AGGCTTGCTGGGGATTTTATAGG + Intronic
1015222181 6:130816802-130816824 AGGCCTGCTGGGATTTTGACTGG - Intergenic
1018127503 6:160695849-160695871 AGGCTTGCTGGGGGTTTTATAGG + Intergenic
1018149019 6:160921203-160921225 AGGCTTGCTGGGGGTTTTATAGG - Intergenic
1018507739 6:164490225-164490247 AGGTCTGCTGGAGTTTGCAGAGG + Intergenic
1018657151 6:166048445-166048467 ATGCCTGCTGGGATTTTTATTGG + Intergenic
1021106734 7:16646348-16646370 CGCCCCGCCGGGGTTTCCATCGG + Intronic
1023676741 7:42637924-42637946 AATCCTGCTGGGGTTTTCACTGG + Intergenic
1023718739 7:43071738-43071760 AGGCCAGCTGGAGTTTCTCTGGG + Intergenic
1024001812 7:45194823-45194845 ACACCTGCTGGGGTCTCCCTTGG - Intergenic
1024230677 7:47361087-47361109 AGGCAGGATGGGGGTTCCATGGG - Intronic
1024543854 7:50500910-50500932 AGGGCTTCTCTGGTTTCCATGGG + Intronic
1024953731 7:54893619-54893641 AGGCCTCCTGCTGTTTCCACAGG + Intergenic
1028645572 7:93093125-93093147 GTGCCTGCTGGGGTGGCCATAGG - Intergenic
1030061208 7:105622739-105622761 AAGTCTGCTGGGGTTTTCATAGG + Intronic
1032704656 7:134411444-134411466 ATGCCTGCTGGCTCTTCCATTGG + Intergenic
1032708045 7:134439173-134439195 AGAGCTGCTGTGGTTTCCGTGGG - Intergenic
1033250879 7:139758102-139758124 AAGCCTGTTGGTATTTCCATTGG - Intronic
1034468395 7:151243163-151243185 ATGCCTGCTGGGCTTCCCCTGGG + Intronic
1034489649 7:151386476-151386498 AGTCCTGCTGGGGTTACGGTGGG + Intronic
1034881620 7:154767180-154767202 AGCCCTGCAGTGGTTTCCACGGG - Intronic
1035884540 8:3277758-3277780 AGGCTGGCTGGTGTTTCCTTAGG + Intronic
1036131794 8:6121615-6121637 AGTGCTGCTGGGGTTCCCACTGG - Intergenic
1038339308 8:26671061-26671083 AGGCTTGCTGGGGCTTTCATAGG + Intergenic
1038789124 8:30651690-30651712 AAGCCTGCTGGGATTTCCATAGG - Intronic
1038922387 8:32099134-32099156 AGGCTTGCTGGGGATTTTATGGG + Intronic
1040841929 8:51793203-51793225 AGGGCTGCTGTGGTTTCCTGGGG - Intronic
1041306523 8:56467061-56467083 AAGCCTGCTGGGATTTTAATTGG + Intergenic
1041972516 8:63760322-63760344 AGGGCTGCTGGGGTTTGCTGGGG + Intergenic
1042894394 8:73651118-73651140 AGGCCTGCCGAGGTCTCCCTGGG + Intronic
1043139945 8:76575564-76575586 AGGACTACTGGGGTTTCAACAGG + Intergenic
1044009958 8:86982822-86982844 AAGCCTGCTGAGGTTTTGATTGG + Intronic
1045856491 8:106770581-106770603 AGGGCTGCTGGGGTTTAAGTGGG - Intergenic
1046678082 8:117134542-117134564 ATGCCTGATAGGGTTTCCTTGGG + Intronic
1046851242 8:118975606-118975628 AGGTCTCCTGGGTTTTCCAGTGG + Intergenic
1048994474 8:139784911-139784933 AGGCCTGCTGGAATTTTAATTGG - Intronic
1049605429 8:143527030-143527052 AGGCCAGCAGGGGTGGCCATCGG + Intronic
1049993741 9:1015152-1015174 GGACCTGCTGGGGTTTTGATTGG + Intergenic
1051736954 9:20210165-20210187 AGACCTGCTGTGGTTTTCTTTGG + Intergenic
1055317670 9:75050113-75050135 AGGCTTGCTGGGGATTTTATAGG - Intergenic
1056581245 9:87889195-87889217 AGCCCGGGTGGGGTCTCCATAGG - Intergenic
1056653846 9:88492932-88492954 AAGCCTGCTGGGATTTTGATAGG - Intergenic
1057046504 9:91890203-91890225 GGTCCTGCTGGTGTCTCCATCGG - Intronic
1058361716 9:104155287-104155309 AGGTCTGTTGTGGTATCCATAGG - Intergenic
1059345745 9:113626801-113626823 AGGGGTGCTGGGGTTGGCATAGG - Intergenic
1059921652 9:119167215-119167237 AGTCCAGCTGGGGTTTCCCCGGG + Exonic
1060402789 9:123357991-123358013 AGGCCTGCTGGGTTGCCCAGGGG + Intronic
1061864537 9:133485577-133485599 AGGCCTGATGTGGGTTGCATAGG - Intergenic
1062047775 9:134432386-134432408 AGGCCTGCCGGGTGTTCCAGAGG + Intronic
1062091949 9:134682975-134682997 AGGCCTGCTGGGGTCTGCATTGG - Intronic
1062459560 9:136657210-136657232 ACCCCTGCTGAGGTTCCCATGGG - Intergenic
1062694352 9:137865662-137865684 AGGCGTGCTGGGGATTTTATAGG + Intronic
1186283307 X:8017807-8017829 AGGCCTGCTGGTCTTTCCTATGG + Intergenic
1187013647 X:15304873-15304895 TGGCTTGATGGGGCTTCCATTGG + Intronic
1187386117 X:18850278-18850300 AAGGCTGCTGGGATTTTCATTGG - Intergenic
1188512412 X:30950576-30950598 ATGCCTGGTGGGGTTTGCAGAGG - Intronic
1189329780 X:40136913-40136935 AGGTCTGCTGTGGTTTCTAAGGG - Intronic
1189446070 X:41083071-41083093 AAGCCTGCTGGGATTTTGATAGG + Intergenic
1189525653 X:41818121-41818143 AGGCCTCCTGGGATTTTTATTGG - Intronic
1190924336 X:54888357-54888379 AGGTCTGCTGTGGTTTGCTTGGG - Intergenic
1190971896 X:55357367-55357389 AGGGCTGCTGTGGTTTGCTTGGG - Intergenic
1192595810 X:72407244-72407266 AGGCCAGCTGGAGTTTCTCTAGG - Intronic
1195395208 X:104403056-104403078 AGGCCTGCTGAGATTTTGATTGG + Intergenic
1196309500 X:114146188-114146210 AATCCTGCTGGGGTTTTGATAGG - Intergenic
1198705519 X:139444004-139444026 AGGGCTGCTGTGGTTTGCTTGGG - Intergenic
1199757780 X:150881270-150881292 AGGCCTGCTGGGGTATAGGTTGG - Intronic
1200050629 X:153428710-153428732 AAGCCTACTGGGGTTTTGATTGG + Intergenic
1201580068 Y:15501912-15501934 AGACTTGCTGGGGATTCTATAGG - Intergenic
1201756779 Y:17494647-17494669 AGGGCTGCTGTGGTTTTCAGGGG - Intergenic
1201844774 Y:18411337-18411359 AGGGCTGCTGTGGTTTTCAGGGG + Intergenic