ID: 1063982504

View in Genome Browser
Species Human (GRCh38)
Location 10:11466007-11466029
Sequence CTGGGCAAAGCAAATGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063982501_1063982504 -7 Left 1063982501 10:11465991-11466013 CCCATCAAAAAAACAACTGGGCA 0: 1
1: 0
2: 2
3: 22
4: 279
Right 1063982504 10:11466007-11466029 CTGGGCAAAGCAAATGTGGAAGG No data
1063982502_1063982504 -8 Left 1063982502 10:11465992-11466014 CCATCAAAAAAACAACTGGGCAA 0: 1
1: 0
2: 0
3: 29
4: 319
Right 1063982504 10:11466007-11466029 CTGGGCAAAGCAAATGTGGAAGG No data
1063982500_1063982504 -6 Left 1063982500 10:11465990-11466012 CCCCATCAAAAAAACAACTGGGC 0: 1
1: 0
2: 1
3: 14
4: 239
Right 1063982504 10:11466007-11466029 CTGGGCAAAGCAAATGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063982504 Original CRISPR CTGGGCAAAGCAAATGTGGA AGG Intronic
No off target data available for this crispr