ID: 1063983885

View in Genome Browser
Species Human (GRCh38)
Location 10:11480403-11480425
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063983882_1063983885 9 Left 1063983882 10:11480371-11480393 CCTCTATATTTGACTTTTACTAA 0: 1
1: 0
2: 2
3: 23
4: 331
Right 1063983885 10:11480403-11480425 TGACCTCTTTTTATAGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr