ID: 1063987266

View in Genome Browser
Species Human (GRCh38)
Location 10:11518224-11518246
Sequence CTGATTTCACAGACTGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063987261_1063987266 -9 Left 1063987261 10:11518210-11518232 CCTACCCAGAGAGGCTGATTTCA 0: 1
1: 1
2: 3
3: 38
4: 249
Right 1063987266 10:11518224-11518246 CTGATTTCACAGACTGAGGTGGG No data
1063987259_1063987266 4 Left 1063987259 10:11518197-11518219 CCTTTAAAAATTACCTACCCAGA 0: 1
1: 0
2: 1
3: 22
4: 244
Right 1063987266 10:11518224-11518246 CTGATTTCACAGACTGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063987266 Original CRISPR CTGATTTCACAGACTGAGGT GGG Intronic
No off target data available for this crispr