ID: 1063995050

View in Genome Browser
Species Human (GRCh38)
Location 10:11611386-11611408
Sequence CCCGCGGAGCCCGCCGCCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063995035_1063995050 14 Left 1063995035 10:11611349-11611371 CCCGGGGCCAACTCCGAGTCCCG 0: 1
1: 0
2: 0
3: 9
4: 81
Right 1063995050 10:11611386-11611408 CCCGCGGAGCCCGCCGCCGCCGG No data
1063995036_1063995050 13 Left 1063995036 10:11611350-11611372 CCGGGGCCAACTCCGAGTCCCGG 0: 1
1: 0
2: 1
3: 17
4: 112
Right 1063995050 10:11611386-11611408 CCCGCGGAGCCCGCCGCCGCCGG No data
1063995034_1063995050 15 Left 1063995034 10:11611348-11611370 CCCCGGGGCCAACTCCGAGTCCC 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1063995050 10:11611386-11611408 CCCGCGGAGCCCGCCGCCGCCGG No data
1063995045_1063995050 -6 Left 1063995045 10:11611369-11611391 CCGGCCCGGGGAGGACGCCCGCG 0: 1
1: 0
2: 2
3: 18
4: 151
Right 1063995050 10:11611386-11611408 CCCGCGGAGCCCGCCGCCGCCGG No data
1063995047_1063995050 -10 Left 1063995047 10:11611373-11611395 CCCGGGGAGGACGCCCGCGGAGC 0: 1
1: 0
2: 0
3: 10
4: 115
Right 1063995050 10:11611386-11611408 CCCGCGGAGCCCGCCGCCGCCGG No data
1063995039_1063995050 7 Left 1063995039 10:11611356-11611378 CCAACTCCGAGTCCCGGCCCGGG 0: 1
1: 0
2: 1
3: 17
4: 125
Right 1063995050 10:11611386-11611408 CCCGCGGAGCCCGCCGCCGCCGG No data
1063995043_1063995050 1 Left 1063995043 10:11611362-11611384 CCGAGTCCCGGCCCGGGGAGGAC 0: 1
1: 0
2: 0
3: 22
4: 154
Right 1063995050 10:11611386-11611408 CCCGCGGAGCCCGCCGCCGCCGG No data
1063995033_1063995050 21 Left 1063995033 10:11611342-11611364 CCGGCTCCCCGGGGCCAACTCCG 0: 1
1: 0
2: 0
3: 10
4: 206
Right 1063995050 10:11611386-11611408 CCCGCGGAGCCCGCCGCCGCCGG No data
1063995044_1063995050 -5 Left 1063995044 10:11611368-11611390 CCCGGCCCGGGGAGGACGCCCGC 0: 1
1: 0
2: 2
3: 18
4: 241
Right 1063995050 10:11611386-11611408 CCCGCGGAGCCCGCCGCCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063995050 Original CRISPR CCCGCGGAGCCCGCCGCCGC CGG Intronic
No off target data available for this crispr