ID: 1064003361

View in Genome Browser
Species Human (GRCh38)
Location 10:11681787-11681809
Sequence GGGTGGGTAAATCCAATCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064003361_1064003369 -4 Left 1064003361 10:11681787-11681809 CCCCAGATTGGATTTACCCACCC No data
Right 1064003369 10:11681806-11681828 ACCCAGTCGGAGGCCATGCAGGG No data
1064003361_1064003373 2 Left 1064003361 10:11681787-11681809 CCCCAGATTGGATTTACCCACCC No data
Right 1064003373 10:11681812-11681834 TCGGAGGCCATGCAGGGTCTGGG No data
1064003361_1064003378 22 Left 1064003361 10:11681787-11681809 CCCCAGATTGGATTTACCCACCC No data
Right 1064003378 10:11681832-11681854 GGGCAGACCCCCGATGTAGGGGG No data
1064003361_1064003376 20 Left 1064003361 10:11681787-11681809 CCCCAGATTGGATTTACCCACCC No data
Right 1064003376 10:11681830-11681852 CTGGGCAGACCCCCGATGTAGGG No data
1064003361_1064003375 19 Left 1064003361 10:11681787-11681809 CCCCAGATTGGATTTACCCACCC No data
Right 1064003375 10:11681829-11681851 TCTGGGCAGACCCCCGATGTAGG No data
1064003361_1064003372 1 Left 1064003361 10:11681787-11681809 CCCCAGATTGGATTTACCCACCC No data
Right 1064003372 10:11681811-11681833 GTCGGAGGCCATGCAGGGTCTGG No data
1064003361_1064003382 30 Left 1064003361 10:11681787-11681809 CCCCAGATTGGATTTACCCACCC No data
Right 1064003382 10:11681840-11681862 CCCCGATGTAGGGGGGTCTCAGG No data
1064003361_1064003368 -5 Left 1064003361 10:11681787-11681809 CCCCAGATTGGATTTACCCACCC No data
Right 1064003368 10:11681805-11681827 CACCCAGTCGGAGGCCATGCAGG No data
1064003361_1064003377 21 Left 1064003361 10:11681787-11681809 CCCCAGATTGGATTTACCCACCC No data
Right 1064003377 10:11681831-11681853 TGGGCAGACCCCCGATGTAGGGG No data
1064003361_1064003379 23 Left 1064003361 10:11681787-11681809 CCCCAGATTGGATTTACCCACCC No data
Right 1064003379 10:11681833-11681855 GGCAGACCCCCGATGTAGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064003361 Original CRISPR GGGTGGGTAAATCCAATCTG GGG (reversed) Intergenic
No off target data available for this crispr