ID: 1064003849

View in Genome Browser
Species Human (GRCh38)
Location 10:11684782-11684804
Sequence GACCCGGGAGTGGCCCTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064003833_1064003849 23 Left 1064003833 10:11684736-11684758 CCTTAGTGACCATCGGGACAAGG No data
Right 1064003849 10:11684782-11684804 GACCCGGGAGTGGCCCTGCCTGG No data
1064003838_1064003849 14 Left 1064003838 10:11684745-11684767 CCATCGGGACAAGGCTGTGGGGA No data
Right 1064003849 10:11684782-11684804 GACCCGGGAGTGGCCCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064003849 Original CRISPR GACCCGGGAGTGGCCCTGCC TGG Intergenic
No off target data available for this crispr