ID: 1064005687

View in Genome Browser
Species Human (GRCh38)
Location 10:11697117-11697139
Sequence CTGAACAACCAGAAGGATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064005687_1064005690 -9 Left 1064005687 10:11697117-11697139 CCTTCATCCTTCTGGTTGTTCAG No data
Right 1064005690 10:11697131-11697153 GTTGTTCAGGTCCAAAACCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064005687 Original CRISPR CTGAACAACCAGAAGGATGA AGG (reversed) Intergenic
No off target data available for this crispr