ID: 1064006829

View in Genome Browser
Species Human (GRCh38)
Location 10:11705430-11705452
Sequence CCTAGCCTGCCGCAGCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064006819_1064006829 22 Left 1064006819 10:11705385-11705407 CCCTCTCTCCCTACCCTAAGAAA No data
Right 1064006829 10:11705430-11705452 CCTAGCCTGCCGCAGCTGGAGGG No data
1064006825_1064006829 8 Left 1064006825 10:11705399-11705421 CCTAAGAAATGGAAGAGCATTCG No data
Right 1064006829 10:11705430-11705452 CCTAGCCTGCCGCAGCTGGAGGG No data
1064006824_1064006829 9 Left 1064006824 10:11705398-11705420 CCCTAAGAAATGGAAGAGCATTC No data
Right 1064006829 10:11705430-11705452 CCTAGCCTGCCGCAGCTGGAGGG No data
1064006820_1064006829 21 Left 1064006820 10:11705386-11705408 CCTCTCTCCCTACCCTAAGAAAT No data
Right 1064006829 10:11705430-11705452 CCTAGCCTGCCGCAGCTGGAGGG No data
1064006822_1064006829 14 Left 1064006822 10:11705393-11705415 CCCTACCCTAAGAAATGGAAGAG No data
Right 1064006829 10:11705430-11705452 CCTAGCCTGCCGCAGCTGGAGGG No data
1064006823_1064006829 13 Left 1064006823 10:11705394-11705416 CCTACCCTAAGAAATGGAAGAGC No data
Right 1064006829 10:11705430-11705452 CCTAGCCTGCCGCAGCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064006829 Original CRISPR CCTAGCCTGCCGCAGCTGGA GGG Intergenic
No off target data available for this crispr