ID: 1064009969

View in Genome Browser
Species Human (GRCh38)
Location 10:11727841-11727863
Sequence GGCCTCACCACCACAGGAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064009969_1064009980 18 Left 1064009969 10:11727841-11727863 CCAACTCCTGTGGTGGTGAGGCC No data
Right 1064009980 10:11727882-11727904 ACAAGTCAGAAAGGCACTCAAGG No data
1064009969_1064009981 19 Left 1064009969 10:11727841-11727863 CCAACTCCTGTGGTGGTGAGGCC No data
Right 1064009981 10:11727883-11727905 CAAGTCAGAAAGGCACTCAAGGG No data
1064009969_1064009982 20 Left 1064009969 10:11727841-11727863 CCAACTCCTGTGGTGGTGAGGCC No data
Right 1064009982 10:11727884-11727906 AAGTCAGAAAGGCACTCAAGGGG No data
1064009969_1064009979 9 Left 1064009969 10:11727841-11727863 CCAACTCCTGTGGTGGTGAGGCC No data
Right 1064009979 10:11727873-11727895 GGGGAAGGCACAAGTCAGAAAGG No data
1064009969_1064009975 -6 Left 1064009969 10:11727841-11727863 CCAACTCCTGTGGTGGTGAGGCC No data
Right 1064009975 10:11727858-11727880 GAGGCCCCTGTTGAGGGGGAAGG No data
1064009969_1064009974 -10 Left 1064009969 10:11727841-11727863 CCAACTCCTGTGGTGGTGAGGCC No data
Right 1064009974 10:11727854-11727876 TGGTGAGGCCCCTGTTGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064009969 Original CRISPR GGCCTCACCACCACAGGAGT TGG (reversed) Intergenic
No off target data available for this crispr