ID: 1064010165

View in Genome Browser
Species Human (GRCh38)
Location 10:11729332-11729354
Sequence TTGCTATTGTAACCTAACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064010165_1064010166 1 Left 1064010165 10:11729332-11729354 CCTGGGTTAGGTTACAATAGCAA No data
Right 1064010166 10:11729356-11729378 CATTTCTATCGAGCTCGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064010165 Original CRISPR TTGCTATTGTAACCTAACCC AGG (reversed) Intergenic
No off target data available for this crispr